ID: 1066066105

View in Genome Browser
Species Human (GRCh38)
Location 10:31762030-31762052
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066066105_1066066106 -9 Left 1066066105 10:31762030-31762052 CCAATGTGATGTTGAGGCAGAGC No data
Right 1066066106 10:31762044-31762066 AGGCAGAGCAACTGTGTTTAAGG No data
1066066105_1066066108 19 Left 1066066105 10:31762030-31762052 CCAATGTGATGTTGAGGCAGAGC No data
Right 1066066108 10:31762072-31762094 TCAAGACTAGCCCACCTGAAAGG No data
1066066105_1066066107 -8 Left 1066066105 10:31762030-31762052 CCAATGTGATGTTGAGGCAGAGC No data
Right 1066066107 10:31762045-31762067 GGCAGAGCAACTGTGTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066066105 Original CRISPR GCTCTGCCTCAACATCACAT TGG (reversed) Intergenic
No off target data available for this crispr