ID: 1066067374

View in Genome Browser
Species Human (GRCh38)
Location 10:31772182-31772204
Sequence GGCACTGATGTGTCTCAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066067374_1066067380 12 Left 1066067374 10:31772182-31772204 CCAGATTGAGACACATCAGTGCC No data
Right 1066067380 10:31772217-31772239 GAGGAGACCCTAGAAGAGTTAGG No data
1066067374_1066067381 13 Left 1066067374 10:31772182-31772204 CCAGATTGAGACACATCAGTGCC No data
Right 1066067381 10:31772218-31772240 AGGAGACCCTAGAAGAGTTAGGG No data
1066067374_1066067378 -7 Left 1066067374 10:31772182-31772204 CCAGATTGAGACACATCAGTGCC No data
Right 1066067378 10:31772198-31772220 CAGTGCCAAGGGAGAGCAGGAGG No data
1066067374_1066067377 -10 Left 1066067374 10:31772182-31772204 CCAGATTGAGACACATCAGTGCC No data
Right 1066067377 10:31772195-31772217 CATCAGTGCCAAGGGAGAGCAGG No data
1066067374_1066067384 24 Left 1066067374 10:31772182-31772204 CCAGATTGAGACACATCAGTGCC No data
Right 1066067384 10:31772229-31772251 GAAGAGTTAGGGAACCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066067374 Original CRISPR GGCACTGATGTGTCTCAATC TGG (reversed) Intergenic
No off target data available for this crispr