ID: 1066071624

View in Genome Browser
Species Human (GRCh38)
Location 10:31820440-31820462
Sequence GTTCACAGTGGACCTCAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066071624 Original CRISPR GTTCACAGTGGACCTCAAGG GGG (reversed) Exonic
901201675 1:7470774-7470796 GTTCACAGTGGGCCGGCAGGAGG - Intronic
902841392 1:19076267-19076289 GGTCACAGTTGACCCCAGGGAGG - Intronic
903982318 1:27198090-27198112 GTTCATAGTGAGCCACAAGGTGG + Intergenic
906144946 1:43554429-43554451 GTGCTCAGAGGACTTCAAGGTGG - Intronic
906822235 1:48941783-48941805 TTTCAAAGTGGAACTCAAAGAGG + Intronic
906872201 1:49495291-49495313 GCTCACAGTGGCCCTGAATGTGG + Intronic
908221662 1:62013431-62013453 GTGCATAGTGGCCCTCAATGAGG - Intronic
909241334 1:73217753-73217775 GTTCACAGTGGAATTTAAGCTGG + Intergenic
910042096 1:82864976-82864998 GTCCACAGTGTTCCTCCAGGTGG + Intergenic
914565990 1:148867030-148867052 GTACACAGAGGACCTCATGTTGG - Intronic
914606832 1:149263210-149263232 GTACACAGAGGACCTCATGTTGG + Intergenic
914829272 1:151158886-151158908 GATCAAAGTGGCCATCAAGGTGG + Exonic
916660143 1:166915954-166915976 GTTCACAGGGGAGCTCAGCGTGG - Exonic
917649923 1:177066237-177066259 GTTCCCACTGGACCTCAGGCTGG + Intronic
922776295 1:228215627-228215649 TTTCTCCGTGGACCTCACGGTGG + Exonic
1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG + Intronic
1063714348 10:8513034-8513056 GTTCAAAGGGGACCTCAGGTGGG - Intergenic
1064255745 10:13741616-13741638 GTTCACACAGGGCCTCATGGGGG + Intronic
1064487206 10:15806078-15806100 GTACACAGTGGTACTCAAGAAGG - Intronic
1066071624 10:31820440-31820462 GTTCACAGTGGACCTCAAGGGGG - Exonic
1067046894 10:42990103-42990125 GTTGGCAGAGGCCCTCAAGGTGG - Intergenic
1067203159 10:44192437-44192459 GGACACAGTGGACCTCATTGTGG - Intergenic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1067759125 10:49029995-49030017 GTTCCCAGTGTACCTCTGGGTGG + Intronic
1069870949 10:71532560-71532582 GTTAAAAGTGGACCTCAGAGAGG - Intronic
1074529657 10:114288574-114288596 GGTGACCTTGGACCTCAAGGTGG - Intronic
1077266702 11:1654502-1654524 GTCCACAGGTGACCTCGAGGTGG - Intergenic
1077738791 11:4821562-4821584 GTTCACAGAGGACCACAAACAGG - Exonic
1079096015 11:17510664-17510686 GTTCCAACTGGCCCTCAAGGAGG + Intronic
1082189143 11:49221289-49221311 GTTTACGCTGGACCACAAGGGGG - Intergenic
1082603536 11:55193552-55193574 TTTCACATTAGACCTCAAAGGGG - Intergenic
1086677378 11:89625399-89625421 GTTTACGCTGGACCACAAGGGGG + Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1089337835 11:117737352-117737374 GTTCCCAGTGGACTTCAGGCAGG + Intronic
1091059552 11:132448743-132448765 GCTAACAGTAGAACTCAAGGAGG + Intronic
1091205986 11:133821554-133821576 GGTCACATTGGACACCAAGGAGG - Intergenic
1092664048 12:10774358-10774380 GTGCCCAGTGGATCTCAAGTGGG - Intergenic
1094627947 12:32142909-32142931 GTTCACAGTGGCACTCCATGAGG + Intronic
1096064304 12:48727326-48727348 GTTCACAGTGGAGCTGGAGTGGG - Intergenic
1098543918 12:71689683-71689705 GATCACAGTGGGGCTCTAGGAGG + Exonic
1099157334 12:79194634-79194656 GTACACAGTGGTTCTCAAAGTGG - Intronic
1099422677 12:82482424-82482446 CTTCACAGTGCAGCTCAAGGGGG + Intergenic
1101878933 12:108613541-108613563 ATTCACAGGGGACTTCCAGGAGG + Intergenic
1105357747 13:19674654-19674676 GAAAACAGTGGAGCTCAAGGAGG + Intergenic
1112190594 13:97173676-97173698 GTTTAGAGTGGACTTAAAGGAGG - Intergenic
1113600372 13:111563994-111564016 GTCCACAGTGGAGCTCAGGCTGG + Intergenic
1119123124 14:72098209-72098231 GTTCAAAGAGGACCTCCAGGAGG - Intronic
1120737143 14:88065829-88065851 GTACACAGTGAACCTCCAGAAGG - Intergenic
1124201462 15:27681928-27681950 GTTCTCAGTGGGCATGAAGGAGG - Intergenic
1129724788 15:77896264-77896286 GCCCACAGGGGACCTCTAGGGGG - Intergenic
1130677865 15:85969670-85969692 GTGCACAGAGGATCTTAAGGTGG - Intergenic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1136671785 16:31864976-31864998 GTTCCCAGTGCACCTGAATGTGG + Intergenic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1138622559 16:58223585-58223607 GTTAATTGTGGATCTCAAGGAGG - Intergenic
1139495252 16:67312188-67312210 GTCCTCAGTGGACTTCAGGGGGG + Intronic
1141529981 16:84639518-84639540 GATCACAGTGGAAGGCAAGGAGG - Intergenic
1142208133 16:88793632-88793654 GTTCCCAGTGGACATGAGGGTGG - Intergenic
1142916153 17:3140340-3140362 GATCAGAGTGGAACTGAAGGAGG - Intergenic
1143517580 17:7427448-7427470 GTGCAGAGAGGGCCTCAAGGTGG - Exonic
1146755033 17:35422648-35422670 GTACAAATTGGAGCTCAAGGTGG + Exonic
1146934507 17:36804158-36804180 ATTCACAAAGGATCTCAAGGGGG + Intergenic
1148152045 17:45402767-45402789 GTACACAGTGGAGCTGAGGGGGG - Exonic
1149361569 17:55901077-55901099 GTGGACAGTGGTCCTCATGGGGG - Intergenic
1150850038 17:68695641-68695663 GATGCCAGTGGACCTCAAAGGGG + Intergenic
1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG + Intergenic
1158618847 18:59012855-59012877 CTACACAGTGGTCCTCAAAGTGG + Intergenic
1158765347 18:60444332-60444354 GATCACAGAGGAGCTGAAGGAGG - Intergenic
1160037953 18:75318878-75318900 GTTCACAGTGCACCTGAAGCAGG - Intergenic
1160887881 19:1360434-1360456 GTGCAAAGTGGACCACAAGAAGG + Exonic
1161735786 19:5991405-5991427 AGCCACAGTGGACCTCAAGGTGG - Intergenic
1162332506 19:10038934-10038956 GTTCACTGTGAACCACAAGATGG + Intergenic
1162332514 19:10038973-10038995 ATTCACTCTGGACATCAAGGTGG + Intergenic
1164418016 19:28062406-28062428 GTTCACAGTGGTCCTCATCAGGG - Intergenic
929214012 2:39391412-39391434 GTGCACAGTTGATCTCTAGGAGG - Intronic
929964309 2:46522088-46522110 GTTCACAGTGGGCATCACAGTGG + Intronic
930052601 2:47228299-47228321 GTTCACAGAGGCCTTCAAGCAGG + Intergenic
932418859 2:71589636-71589658 GTTCACACCGAAGCTCAAGGTGG - Exonic
932440734 2:71733091-71733113 GCTCACAGTGGACCTCCCGCTGG + Intergenic
935566123 2:104609103-104609125 ACTAACAGTGGATCTCAAGGCGG + Intergenic
937662954 2:124451929-124451951 CTTCACAGTGGACCTTCAGGAGG + Intronic
942255493 2:174092949-174092971 ATTCACAGTGAACCTTGAGGTGG - Intronic
942735349 2:179104604-179104626 GTTCCCAGTGAATCTCCAGGAGG - Exonic
943218232 2:185067437-185067459 GTTCACAGTGGCCCTGATGAAGG - Intergenic
946277966 2:218644787-218644809 GGGCACAGTGGAACTCACGGAGG + Exonic
946446131 2:219741210-219741232 GTTCACAGTCGCCCTCCATGTGG - Intergenic
1172116655 20:32577039-32577061 GTTCACTGTGGGCCTTGAGGAGG + Intronic
1172174047 20:32961563-32961585 CTTCACAGAGGACATGAAGGTGG - Intergenic
1172518907 20:35554797-35554819 GTTCCCTGTGGACGTCAGGGAGG + Intronic
1176318514 21:5279168-5279190 TTCCACAGTTGACCTCAAAGCGG + Intergenic
1176476490 21:7218505-7218527 TTCCACAGTTGACCTCAAAGCGG + Intergenic
1178514029 21:33230659-33230681 AATCCCAGGGGACCTCAAGGGGG - Intronic
1179094100 21:38296640-38296662 GTTCATAGCGGGCCTCAATGAGG + Intronic
1179348716 21:40586205-40586227 GTTCACAGTGGAAGGCAAAGGGG - Intronic
1180859083 22:19066866-19066888 GTTCACAGTGCAGCCCCAGGGGG - Intronic
1183338882 22:37267150-37267172 GTTCACAGGGGAGCCCCAGGCGG + Intergenic
1184583320 22:45431187-45431209 GGACACTGTGGACCTCAAGTGGG + Intronic
1184895437 22:47403929-47403951 GTTCACAGGGGTCCTTAAGGAGG - Intergenic
949193577 3:1279311-1279333 ACTCACAGTGAACCTGAAGGAGG + Intronic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
950973955 3:17220436-17220458 GTTCACAAAGGACCTTAAAGCGG - Intronic
952879536 3:37974810-37974832 GTGCCCAGAGGACCTCTAGGGGG + Intronic
954795498 3:53159630-53159652 GCTTACTGTGGACCTGAAGGAGG + Intronic
957676147 3:83367647-83367669 GTTCTCAGTGAACATCAAGTAGG + Intergenic
960668339 3:120132513-120132535 GTTAAGAGTGGAACTAAAGGTGG + Intergenic
962165784 3:133046303-133046325 CTTTACAGTGCACCTCAAGAGGG - Intronic
962819524 3:139034722-139034744 GAACACAGAGGACCTCTAGGGGG - Intronic
962908899 3:139829823-139829845 GACCACAGAGGACCTCTAGGAGG + Intergenic
963913178 3:150832308-150832330 CTTTACAGTGATCCTCAAGGTGG - Intergenic
964837056 3:160950588-160950610 CTTTAGAGTGGACCTCCAGGAGG - Intronic
968922619 4:3530575-3530597 GTGCCCAGTGAACCTCAGGGAGG + Intronic
972719629 4:41683146-41683168 TTTCACTGTGGACCTGAAGTTGG + Intronic
972805418 4:42525294-42525316 GTGCACAGTGGATCTCGAAGGGG + Intronic
973026860 4:45283985-45284007 GTTCTCAGGGGACCTGAAGTGGG + Intergenic
980196547 4:129596212-129596234 GTTCTCAGTAGAGCTCCAGGAGG - Intergenic
982269712 4:153573944-153573966 GTACACAGTAGGCCTCAAAGGGG - Intronic
986759870 5:10870127-10870149 GTCCAAAGTGGACCGGAAGGTGG + Intergenic
990556876 5:56945108-56945130 TCTCACAGTGAACATCAAGGGGG + Intronic
991199287 5:63972674-63972696 GATCAGAGTGGAACTGAAGGAGG + Intergenic
996356218 5:122599154-122599176 GAACACAGTGGGTCTCAAGGGGG + Intergenic
999983081 5:156976505-156976527 GTTCCCACTGGAGCTCAAGTGGG - Intergenic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1003572099 6:7262424-7262446 AGTCACAGGGGGCCTCAAGGAGG - Intergenic
1006438103 6:34036964-34036986 GCTCACAGTGGTCCCCAGGGCGG + Intronic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1015108806 6:129568671-129568693 GTTCACAGTGGCTGGCAAGGTGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018639123 6:165890620-165890642 TTTCTCAGTGGATCTCAAGTAGG + Intronic
1018823943 6:167395326-167395348 GCTCACAGAGGACCTCATGTGGG - Intergenic
1021107978 7:16660838-16660860 GTTCACAAAGGACCTCCTGGGGG + Intronic
1021586794 7:22217397-22217419 GTTCACAGTGTTCATGAAGGTGG - Intronic
1029214138 7:98933354-98933376 CTTCACAATGGACCTTAACGTGG + Exonic
1032518260 7:132522954-132522976 GTGCACAATGGAGCTCAAGGAGG + Intronic
1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG + Intronic
1034472492 7:151262836-151262858 CTTCACAGAGGAGCCCAAGGAGG - Intronic
1036504042 8:9339220-9339242 TTTCAAGGTTGACCTCAAGGTGG - Intergenic
1036713241 8:11096665-11096687 GGGCAAAGTGGACCTCATGGGGG - Intronic
1039365513 8:36924312-36924334 TCTCACTGTGGACCTCCAGGAGG - Intronic
1046986302 8:120391935-120391957 CCTCACAGGGGACCTCATGGAGG - Intronic
1048676647 8:136791413-136791435 GTTGACAGTAGACCTCATGAGGG - Intergenic
1049250518 8:141586318-141586340 GATCACAGTGGAAGGCAAGGAGG - Intergenic
1049426512 8:142540318-142540340 GTTCACAGGAGACCCCAAGGGGG - Intronic
1203411925 Un_KI270579v1:21191-21213 TTCCACAGTTGACCTCAAAGCGG + Intergenic
1186635959 X:11405232-11405254 GGTCACCTGGGACCTCAAGGTGG - Intronic
1188697709 X:33216397-33216419 GTACACAGTGGACATAAAGATGG + Intronic
1189708953 X:43789314-43789336 TTTAACAGTGGCCCTCTAGGGGG + Intronic
1191155537 X:57268639-57268661 GTTAACAGTGGACCTCTAACTGG + Intergenic
1196413299 X:115443431-115443453 CTTCACTGTGGACATCCAGGTGG - Intergenic
1198649520 X:138846374-138846396 CTTCACAGAGGACTTCAATGGGG - Intronic
1201329565 Y:12803297-12803319 GGACACAGTGGTGCTCAAGGTGG - Intronic