ID: 1066072672

View in Genome Browser
Species Human (GRCh38)
Location 10:31835912-31835934
Sequence GTGGCTATCACCTCTGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066072672_1066072675 26 Left 1066072672 10:31835912-31835934 CCTATAACAGAGGTGATAGCCAC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1066072675 10:31835961-31835983 CTGAACTGTACCCTTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066072672 Original CRISPR GTGGCTATCACCTCTGTTAT AGG (reversed) Intronic
908632002 1:66119562-66119584 GTGGCAATAACATCAGTTATGGG - Intronic
909622217 1:77682020-77682042 GTGCCTATTAACTCAGTTATCGG - Intronic
909816901 1:80005865-80005887 ATGGATATCACCACAGTTATTGG + Intergenic
910503800 1:87925725-87925747 GTGGCTATAACCCCTGCCATAGG - Intergenic
911301112 1:96175575-96175597 GTGTCTATCACTTCTGTTTATGG + Intergenic
915365812 1:155315117-155315139 GTTGCAATCACTGCTGTTATAGG - Intronic
920406488 1:205717044-205717066 GTGCCAACCACCTCTGCTATAGG - Exonic
922737923 1:227999368-227999390 GTGGGTATGACCTCTCTCATGGG - Intergenic
1065630764 10:27678597-27678619 GTGGCTATCAAATATGTTATGGG + Intronic
1066072672 10:31835912-31835934 GTGGCTATCACCTCTGTTATAGG - Intronic
1066544648 10:36486739-36486761 GTGACATTCACCTCTGTTGTAGG - Intergenic
1072706570 10:97685528-97685550 ATTGCTATCACCTGGGTTATTGG - Intronic
1087690944 11:101320220-101320242 GTGGCCATCACCACTGAGATTGG + Intergenic
1088170803 11:106994198-106994220 GTGGTTATCATCACTATTATTGG + Intronic
1089004568 11:115080530-115080552 ATGGGTTCCACCTCTGTTATAGG + Intergenic
1089390343 11:118097669-118097691 GTTATTATCACCTCTGTTCTAGG + Intronic
1090607652 11:128438312-128438334 GTGGCTATATCTGCTGTTATTGG - Intergenic
1091948869 12:4574577-4574599 ATGAATATCACCTCTGTTCTAGG + Intronic
1092277959 12:7076556-7076578 GAGGCTCTCGCCTCTGTTGTAGG - Intergenic
1101573045 12:105972741-105972763 GTGATTATCACTTCTATTATTGG + Intergenic
1101906917 12:108833833-108833855 GAGGCTATCAGCTGTGGTATAGG + Intronic
1102814058 12:115848646-115848668 TTGACAATCACCTCTTTTATTGG + Intergenic
1105758260 13:23489664-23489686 GTGGCTGTCACCAAGGTTATTGG - Intergenic
1105800554 13:23899220-23899242 GTGGCTATCAGCACTGTGAGAGG - Intronic
1111723675 13:91977686-91977708 TTGGCTATGACCACTTTTATGGG - Intronic
1118158717 14:63267326-63267348 ATGGCTCTGACCTATGTTATGGG - Intronic
1118458239 14:65964195-65964217 GGGGCTTTCACCTCTTTTCTGGG + Intronic
1118934488 14:70274415-70274437 TTGGCTAGCACCTCTGTTCATGG - Intergenic
1120262278 14:82200816-82200838 GTTTCTATCTCCTCTATTATAGG - Intergenic
1124926670 15:34076681-34076703 GTGGCAATCACATCTATTTTAGG + Intergenic
1131301268 15:91201713-91201735 GTTGCTATCACATCTTTTATCGG + Intronic
1138395191 16:56698606-56698628 GTGGCTCACACATCTGTAATTGG + Intronic
1149383427 17:56117608-56117630 TTGGCTATCTCCTGTGTAATTGG - Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1161947011 19:7443740-7443762 CTGGCTATCAAGTCTGTTTTAGG - Intronic
1162996212 19:14337289-14337311 CTGGCTATCTCCTCTGATCTGGG + Intergenic
1166289812 19:41855510-41855532 GTGGCTCACACCTCTGATCTCGG + Intergenic
926033550 2:9614855-9614877 TAGTCTATCAGCTCTGTTATGGG + Intronic
931916113 2:66958304-66958326 TTTCTTATCACCTCTGTTATAGG + Intergenic
932515709 2:72346250-72346272 GTGGCTATCTTCTCATTTATGGG - Intronic
935939548 2:108223747-108223769 GTGGCTTTCACCCATGTTAACGG + Intergenic
937021256 2:118658437-118658459 TTGGCTATCATCTTTGTTGTCGG + Intergenic
937802809 2:126100253-126100275 GTAGGTCTCACCTCTGATATTGG - Intergenic
941533812 2:166698086-166698108 GTGTTTATCACCTCTGATATTGG - Intergenic
943456668 2:188116610-188116632 CTGGCTATCATCTCTGTTGAAGG + Intergenic
946536445 2:220635002-220635024 CTGGCTATCTCCTCTGTGCTAGG - Intergenic
1171327196 20:24305155-24305177 GTGGTTATCCCCTCTGCTTTGGG + Intergenic
949879917 3:8653064-8653086 GTGGCTATCATTTCGGTTTTTGG - Intronic
950423332 3:12911264-12911286 GTTGCTGTCACCTGTGTTCTGGG + Intronic
953441697 3:42924209-42924231 GTGGCTTTCACCCATGTTAACGG + Intronic
955058803 3:55479331-55479353 GTGGATAACACCTCTGTTTTTGG - Exonic
962249133 3:133824341-133824363 GTGGCAATTCCATCTGTTATGGG - Exonic
962292318 3:134147077-134147099 GTGGCCATCACGTCTGTCCTTGG - Intronic
963259554 3:143178486-143178508 TTGGCTATCACCCCTAATATGGG - Intergenic
963464816 3:145665751-145665773 CTTACTATCACCTCTGTGATAGG - Intergenic
973711443 4:53633757-53633779 GTGGCAATCAGCTCTCTTCTGGG - Intronic
975856253 4:78627686-78627708 ATTGCTATCTCCTCTGTTATGGG - Intergenic
981456735 4:144961787-144961809 GTGGCTTTCACCCATGTTAATGG - Intergenic
987336437 5:16901632-16901654 GTGGGTATCACTTTTATTATTGG - Intronic
990770460 5:59238218-59238240 GGGGCTATTACTTATGTTATGGG + Intronic
993570026 5:89525480-89525502 GTAGCCATCTCCTCTGTGATAGG - Intergenic
995581648 5:113608538-113608560 GTTGCTATCATCTTTGTTTTAGG + Intergenic
997665949 5:135629596-135629618 CTGGCTAACACATCTTTTATCGG - Intergenic
997722250 5:136088583-136088605 GTGGCTCCCACCTCTGGTTTGGG + Intergenic
998823158 5:146075121-146075143 GTGGCTGTCACATTTGTTACTGG - Intronic
999493752 5:152076644-152076666 GTGGGTATCACTTCTGTTTCAGG + Intergenic
1006186714 6:32185494-32185516 TTGGCTATCACCCCTAATATGGG + Exonic
1008942151 6:57058508-57058530 CTGGCTAGCATCCCTGTTATTGG - Intergenic
1009613915 6:65980960-65980982 TTGGTTATCACCTTTGTTAATGG + Intergenic
1022000024 7:26217763-26217785 GTTGCTAGCAGCTCTGTTTTCGG - Intergenic
1028101039 7:86821040-86821062 GTGACTATTACCTCTGCTACAGG - Intronic
1031991799 7:128203367-128203389 TTGGCCATCACCTCTGTTCAAGG - Intergenic
1033951400 7:146788997-146789019 GTGAATATCAGCTCTGTTCTTGG - Intronic
1034728030 7:153358470-153358492 GGGGCTACCAACTCTGATATTGG + Intergenic
1035402307 7:158574889-158574911 GTGGCTCTCACCTCTGCTGCTGG - Intronic
1037232883 8:16680959-16680981 GTGGCTTTCCACTCTGTTAGGGG - Intergenic
1039864921 8:41491858-41491880 GTGGCTCTCTCCTCTGTGACAGG + Intronic
1043472055 8:80572918-80572940 GTTTCTATCACCTCAGTTCTGGG - Intergenic
1045361552 8:101437945-101437967 GTGCCTTTCACCAGTGTTATAGG + Intergenic
1055778037 9:79787657-79787679 GTAGCTAATACCTTTGTTATGGG - Intergenic
1056568647 9:87797054-87797076 CAGGCTATCACCACTGTTCTTGG + Intergenic
1057265277 9:93613370-93613392 GGGGCTATAACTTCTGTTACAGG - Intronic
1057953296 9:99386893-99386915 GTGGCTATCATTTGTGTTATTGG - Intergenic
1060589571 9:124808347-124808369 GGGGTTATCACCTGTTTTATAGG + Intronic
1185485515 X:478751-478773 GTGGCTATGACATCTGTAAATGG + Intergenic
1197325101 X:125083129-125083151 GTGGATATCACCTTTGTCCTTGG + Intergenic