ID: 1066073900

View in Genome Browser
Species Human (GRCh38)
Location 10:31852545-31852567
Sequence CAATATTACTACAGTGCAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066073900_1066073902 25 Left 1066073900 10:31852545-31852567 CCGTCTGCACTGTAGTAATATTG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1066073902 10:31852593-31852615 AGCCACTATAAAAACAGAACAGG 0: 1
1: 0
2: 2
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066073900 Original CRISPR CAATATTACTACAGTGCAGA CGG (reversed) Exonic
904750759 1:32740544-32740566 CAGGATTACTAGAGTGCAGTGGG - Intergenic
905696326 1:39976735-39976757 CAATTTTACTTCTGCGCAGAGGG + Intergenic
906838290 1:49108117-49108139 CAACGTTCTTACAGTGCAGAGGG - Intronic
908203895 1:61825192-61825214 CAATATTATCACTGTGAAGAAGG + Intronic
912317819 1:108682097-108682119 CAATTTTACTTCTGTGCAGAGGG - Intergenic
912510194 1:110184521-110184543 CATTATCACCACTGTGCAGATGG + Intronic
912859701 1:113202742-113202764 CAATTTTACTTCTGTGCAGAGGG - Intergenic
918413651 1:184285958-184285980 CAATATTTTTACAGTCCAGGAGG + Intergenic
921544330 1:216456006-216456028 AAATATTCCTACAATGCAAAGGG + Intergenic
921910412 1:220542823-220542845 CAGAATTTCTACAGTGCAGTAGG - Intronic
923797003 1:237166737-237166759 AAATTGTACTGCAGTGCAGAAGG + Intronic
924449560 1:244165300-244165322 CAGTATGACTGTAGTGCAGAGGG + Intergenic
924642373 1:245846430-245846452 AACTATTACTACACTACAGAGGG - Intronic
1063886052 10:10580044-10580066 CACTATTATTACTGTGTAGAAGG - Intergenic
1064175902 10:13074804-13074826 CAATATTACCACATTCCAGGAGG + Intronic
1066073900 10:31852545-31852567 CAATATTACTACAGTGCAGACGG - Exonic
1068102339 10:52571188-52571210 CTATATTACCATACTGCAGAAGG + Intergenic
1070450810 10:76555210-76555232 CAATATTAGTACAATGCTGATGG + Intronic
1070991702 10:80739060-80739082 CAATTTTACTTCTGCGCAGAGGG - Intergenic
1070992902 10:80747951-80747973 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1071048315 10:81412711-81412733 GAATAATACTACAGTGAATATGG + Intergenic
1071203754 10:83251191-83251213 CTAAATTACTACAGTGTATATGG + Intergenic
1075523749 10:123164411-123164433 CAATCTTATTAGGGTGCAGAAGG + Exonic
1077816416 11:5690240-5690262 CAATTTTATTTCTGTGCAGAGGG + Intronic
1080086974 11:28294773-28294795 CCATAGTGCTACAGTGCAAAAGG - Intronic
1080151832 11:29060060-29060082 TAATATTACTAGAGTTCACAAGG + Intergenic
1081778700 11:45694947-45694969 CAATTTTGCTTCTGTGCAGAGGG + Intergenic
1083383258 11:62286087-62286109 TAATTTTACTTCTGTGCAGAGGG - Intergenic
1085773019 11:79341420-79341442 CAATCTTACTGCAATGCAGCTGG + Intronic
1090550684 11:127816520-127816542 CAATTTTAACACTGTGCAGATGG + Intergenic
1092189395 12:6507420-6507442 CAATTTTACTTCTCTGCAGAGGG + Intronic
1093446070 12:19260008-19260030 CAATTTTGCTACATTGCATATGG + Intronic
1097559625 12:61186748-61186770 CAATAAAACTAGAGTTCAGAAGG + Intergenic
1099495713 12:83343454-83343476 CACTATTAGGGCAGTGCAGAGGG + Intergenic
1100469828 12:94880517-94880539 GAATTTAACTACAGTCCAGATGG + Intergenic
1101555353 12:105803529-105803551 CAATACAACTGCAGTGCAGTGGG - Intergenic
1105218148 13:18302049-18302071 CAATACTACTTCAGCCCAGACGG + Intergenic
1106141154 13:27013218-27013240 CAAAAATACTACAATGCATATGG + Intergenic
1106362710 13:29047060-29047082 CAATTTTACTTCTGCGCAGAGGG - Intronic
1106883123 13:34153457-34153479 CAATTTTACCTCTGTGCAGAGGG + Intergenic
1107318163 13:39156753-39156775 CCATATAACTACATTGTAGAAGG - Intergenic
1107400816 13:40067225-40067247 CAATCTTACAAAAGTGCTGAAGG + Intergenic
1107608962 13:42093400-42093422 CAATTATACGTCAGTGCAGAAGG - Intronic
1108682776 13:52793679-52793701 CATTATAACGACATTGCAGAAGG + Intergenic
1110497987 13:76190974-76190996 CAAAGTTTCCACAGTGCAGAAGG - Intergenic
1114488918 14:23083845-23083867 CAATGTTAATACAGTACAAAAGG + Intronic
1116303800 14:43222019-43222041 GAATAGTGCTACAGTGCACATGG + Intergenic
1117513757 14:56479486-56479508 TTCTATTACTACAGGGCAGAAGG + Intergenic
1118017124 14:61671928-61671950 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1123867751 15:24538736-24538758 CAATCTGAATAAAGTGCAGATGG - Intergenic
1123899207 15:24859213-24859235 CAATTTTACTTCTGCGCAGAGGG - Intronic
1125825276 15:42671347-42671369 CAATTTTACTTTTGTGCAGAGGG + Intronic
1127648299 15:60980149-60980171 CCATATTAATACAATGAAGAGGG - Intronic
1135979421 16:27135756-27135778 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1137346664 16:47668114-47668136 CAATATTACTTCAGTGCTTAGGG - Intronic
1139050479 16:63119330-63119352 AAAAATTACAGCAGTGCAGAAGG - Intergenic
1140526155 16:75624597-75624619 CAGTACTACTACAGTGTAGTGGG + Intergenic
1142553528 17:756065-756087 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1143715920 17:8768893-8768915 CAATTTTACTTCTGTGCAGAGGG - Intergenic
1148350711 17:46940134-46940156 CAACATGACTACAGAGCAGCGGG - Intronic
1150512585 17:65772647-65772669 CAAAACTAACACAGTGCAGAGGG - Intronic
1154408138 18:14115621-14115643 AAATAATACTACAGTGAATATGG - Intronic
1157364660 18:47053582-47053604 CAATGTTACTACAAAGCACAGGG - Intronic
1159534564 18:69699524-69699546 TAATATTACTGTAGTGCAAAAGG - Intronic
1161565689 19:5000701-5000723 CAATATAACCACAGTAAAGAAGG - Intronic
1162266648 19:9581204-9581226 CAATTTTACTTCTGTGCAGAGGG + Intronic
1162450572 19:10751875-10751897 CAATTTTACTTCTGTACAGAGGG + Intronic
926381737 2:12297302-12297324 CACCATTACCAGAGTGCAGATGG + Intergenic
929707813 2:44234189-44234211 AAATATTTCTAGAGTACAGAAGG - Intronic
931405278 2:61971180-61971202 CAATTTTACTTCTGCGCAGAGGG + Intronic
932885589 2:75546479-75546501 TTTTATTACTACAGTTCAGATGG - Intronic
935501077 2:103839908-103839930 CAATTTTAATACAGAGCTGAAGG + Intergenic
935815186 2:106840910-106840932 CAATATTAATAATGTGGAGAAGG - Intronic
936157176 2:110055494-110055516 CAATTTTACCTCCGTGCAGAGGG - Intergenic
936187518 2:110315950-110315972 CAATTTTACCTCCGTGCAGAGGG + Intergenic
938309710 2:130281016-130281038 CTATATTACTAGAGTGGAGTAGG - Intergenic
938557970 2:132443297-132443319 CAATATTACTAAAGTACAGATGG + Intronic
938628420 2:133137819-133137841 CAATTTTACTTCCGCGCAGAGGG + Intronic
938628499 2:133138541-133138563 CATGATTCCTACAGTGGAGAAGG + Intronic
939705938 2:145453621-145453643 CAATTTTATTACAGAGAAGAGGG - Intergenic
941867136 2:170346641-170346663 CACTTTTACTACTGTGCAGTTGG - Intronic
945632294 2:212295050-212295072 CAATATTTTTTCAGTCCAGATGG - Intronic
1168768964 20:402034-402056 CAATATGGATACAGTGCAAAAGG + Intergenic
1168861590 20:1049510-1049532 CACTCTTAATACACTGCAGAGGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172490595 20:35333733-35333755 CAATATTTTAAGAGTGCAGAAGG + Intronic
1172597203 20:36157652-36157674 GAATATTACTATAGTGCTGAGGG + Intronic
1172984204 20:38969813-38969835 CAATAATTCTCCAGTACAGATGG + Intronic
1172997402 20:39081439-39081461 CAAAATATCAACAGTGCAGAGGG - Intergenic
1175485087 20:59339960-59339982 CACTATCCCTACAGTGCAAATGG - Intergenic
1177267604 21:18804581-18804603 CAATTTTACTTCTGCGCAGAGGG - Intergenic
951173252 3:19568106-19568128 CAAAGCTTCTACAGTGCAGAAGG + Intergenic
952275407 3:31871126-31871148 CAAACCTTCTACAGTGCAGAAGG - Intronic
953448431 3:42987101-42987123 CAATTTTACTTCTGCGCAGAGGG + Intronic
953512691 3:43558823-43558845 CAACATCACTCCAGTGGAGACGG + Intronic
955180765 3:56667148-56667170 CAATATTGCTACTGTCCAGAGGG + Intronic
955468611 3:59262694-59262716 CAAAAGTACTTTAGTGCAGAAGG + Intergenic
955744713 3:62128771-62128793 AAATATGACAACAGTGAAGAGGG - Intronic
956295369 3:67706459-67706481 GAAAATTACTAGACTGCAGAAGG + Intergenic
957681202 3:83438518-83438540 TAATATTACTACAGTGGGGCTGG - Intergenic
959773595 3:110130017-110130039 TATTGTTGCTACAGTGCAGAAGG - Intergenic
962182056 3:133216875-133216897 GAATATTGCTACAGTGAACATGG + Intronic
962244727 3:133783126-133783148 AAAGATTACTACAGTGAAGGAGG - Intergenic
962973176 3:140424004-140424026 CAATTTTACTTCTGTGCAGAGGG - Intronic
965716993 3:171615464-171615486 CAATATTACCACATCCCAGAAGG + Intronic
965866704 3:173214199-173214221 CAATAATATTAGAGTGCAAAGGG - Intergenic
965969266 3:174533266-174533288 CAATTTTACTTCTATGCAGAGGG - Intronic
967524861 3:190479979-190480001 TAATATTAACACAGTGAAGAGGG + Intergenic
968268636 3:197382370-197382392 CAATATTGCCACATTACAGATGG + Intergenic
970865565 4:20755121-20755143 TCTCATTACTACAGTGCAGAGGG - Intronic
971076467 4:23154904-23154926 CAATTTTACTTCTGCGCAGAGGG + Intergenic
971153102 4:24054911-24054933 CAATATTACTAAATTGCATTAGG + Intergenic
971430540 4:26561674-26561696 CCATATTACTAAAATGAAGAGGG - Intergenic
971530640 4:27684198-27684220 AAATATTACTACAGAGTGGAGGG + Intergenic
973222351 4:47742959-47742981 CAGTGATATTACAGTGCAGAGGG + Intronic
975741141 4:77430156-77430178 AAATATCACTGCAGTACAGAAGG + Intronic
978310324 4:107379950-107379972 CAATTTTACTTCTGTGCAGAGGG - Intergenic
978456211 4:108895261-108895283 GAAAATTACTACAGTACAGATGG - Intronic
984983770 4:185307670-185307692 CCATGTTACTACAGTGGAGGAGG + Intronic
985983779 5:3495615-3495637 GAATATGACTAAAGTGCTGAAGG - Intergenic
986812485 5:11374670-11374692 CAATATTCCAACAGTGCATCTGG + Intronic
987161505 5:15148944-15148966 CGATATTGCTACAGTCCACAAGG + Intergenic
987181948 5:15377290-15377312 TAATATTTCTACAGTGTCGATGG + Intergenic
987865309 5:23528600-23528622 CAATTTTACTTCTGTGCAGAGGG + Intergenic
988111054 5:26820476-26820498 TACTATTAATACAATGCAGATGG + Intergenic
988392529 5:30654120-30654142 CAATATTACTAATGTGGAGATGG + Intergenic
991984930 5:72275649-72275671 CAATTTTACTTCTGCGCAGAGGG + Intronic
995165608 5:109036856-109036878 CAATATCACTAGGGTGCATAAGG - Intronic
995408301 5:111827001-111827023 CAATTTTACCCCAGTGCATAAGG - Intronic
995760718 5:115558657-115558679 TACAATTACTACAGTGCATAGGG - Intergenic
998044203 5:138973017-138973039 CAGTATTCCTACAGTACAGCAGG + Intronic
998055043 5:139067531-139067553 CAATATTACTAGAGACCAGCTGG + Intronic
999470746 5:151852757-151852779 GAATATTACTGCAGTGAACATGG + Intronic
999629491 5:153555485-153555507 CAACATTCCTCCAGTGCAGCAGG - Intronic
1000103633 5:158038185-158038207 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1003187399 6:3844308-3844330 CAATAATACAACAGAGGAGAGGG - Intergenic
1004236159 6:13876338-13876360 CAATATTTTTAAAGTGCTGAAGG + Intergenic
1005437163 6:25826574-25826596 TAACATTACAACAGTGCACAAGG + Exonic
1008035374 6:46739831-46739853 CAAATTTACTTCGGTGCAGAAGG + Intergenic
1008197778 6:48546109-48546131 AAAGATTACTACAGCCCAGATGG + Intergenic
1009737752 6:67700209-67700231 CAATGTACCTACAATGCAGATGG + Intergenic
1010360469 6:74987293-74987315 CTCTATTAGGACAGTGCAGAGGG + Intergenic
1012907880 6:105089187-105089209 CAATATTCCTATATTACAGATGG + Intergenic
1013615076 6:111835456-111835478 CAATTTTACTTCTGCGCAGAGGG + Intronic
1013711893 6:112910643-112910665 CAATATGAATACAGACCAGAAGG + Intergenic
1014307837 6:119764858-119764880 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1014708424 6:124777139-124777161 AAATAATATTAAAGTGCAGATGG + Intronic
1014848311 6:126307852-126307874 CTATATTAGTACATTCCAGAAGG + Intergenic
1018255810 6:161917785-161917807 CTATATTACTTCTGTGCAGCAGG - Intronic
1018499229 6:164386248-164386270 AAATAGTACTACAGTTCAGTGGG - Intergenic
1019899419 7:4008370-4008392 CAATTTTACTTCTGCGCAGAGGG + Intronic
1022062310 7:26809805-26809827 GAATAATGCTACAGTGAAGATGG - Intronic
1024383183 7:48722806-48722828 CTCTATTAGGACAGTGCAGAGGG - Intergenic
1026366735 7:69655868-69655890 CAATAGTACAACAGCCCAGAGGG - Intronic
1026477560 7:70750016-70750038 CAATATCACTGCAGAGCAGGAGG - Intronic
1029907614 7:104107321-104107343 CAATATTAATAAAGTACATAAGG - Intergenic
1030205754 7:106951042-106951064 CTATATTAACACAATGCAGAAGG + Intergenic
1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG + Intergenic
1032646879 7:133834535-133834557 CAATTTTACTTCTGCGCAGAGGG - Intronic
1033312306 7:140270934-140270956 CAAAATTTCCACAGTACAGAAGG + Intergenic
1034687994 7:152990329-152990351 CAATTTTACTTCCGTGCAGAGGG - Intergenic
1035147029 7:156829194-156829216 CAATTTTACTTCTGCGCAGAGGG - Intronic
1038949074 8:32393978-32394000 AAATATTAGGACAGAGCAGATGG - Intronic
1039014330 8:33129362-33129384 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1039756131 8:40524993-40525015 CAATTTTACTCCAGCACAGAAGG - Intergenic
1040620960 8:49092284-49092306 CAAAATTACCAAAGAGCAGATGG - Intergenic
1041038235 8:53817664-53817686 CATTATTACTACGGGGCAGGGGG + Intronic
1041420081 8:57657720-57657742 CAACATTACTACAGGGTAAACGG - Intergenic
1044243205 8:89911295-89911317 AAATGTTACTACAGAGCAAAAGG - Intronic
1045798969 8:106079561-106079583 CAAAATCTCTACACTGCAGAAGG - Intergenic
1046133125 8:109993076-109993098 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1046726086 8:117675410-117675432 CAATATAATTCCAGTGGAGATGG + Intergenic
1048592652 8:135835473-135835495 CAAAATTACTGCAGTACAGGAGG + Intergenic
1050754203 9:8979912-8979934 GAATATTACTGCAGTGAACATGG - Intronic
1050835609 9:10074823-10074845 CTATATTACAACATTTCAGATGG - Intronic
1051720603 9:20033206-20033228 CACTATTACTACACTGCTCAAGG - Intergenic
1053477738 9:38394165-38394187 CAATTTTACTTCTGCGCAGAGGG - Intronic
1055194284 9:73568391-73568413 GAATAGTATTACATTGCAGAAGG - Intergenic
1055212704 9:73816830-73816852 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1055221236 9:73934443-73934465 TAATATTACTACAGTAAACAGGG - Intergenic
1055330487 9:75178209-75178231 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1055832859 9:80403122-80403144 AAATATTATTGCAGTGCAGGTGG - Intergenic
1057094697 9:92295249-92295271 CAATTTTACTTCTGCGCAGAGGG + Intergenic
1058307466 9:103461125-103461147 CAATTTTACTTCTGCGCAGAGGG - Intergenic
1058566233 9:106288150-106288172 GACTTTTACTACAGGGCAGAAGG + Intergenic
1059757489 9:117307325-117307347 CAATAATGCTACAGAGTAGAAGG + Intronic
1060364359 9:122994562-122994584 AAATAGTAATAAAGTGCAGAAGG + Intronic
1186156301 X:6730017-6730039 CAATTTTACTTCTGCGCAGAGGG - Intergenic
1188903541 X:35763636-35763658 GAATATTGCTGCAGTGAAGATGG - Intergenic
1189372338 X:40438821-40438843 CAATTTTACTTCTGTGTAGAGGG + Intergenic
1190490481 X:50978153-50978175 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1193017133 X:76747854-76747876 AAATATTATTACAGAGCAGTTGG + Intergenic
1194801738 X:98282292-98282314 CAATATGACTACATTACAAAAGG - Intergenic
1196339079 X:114575151-114575173 GAATAGTACTACAGTGAACATGG - Intergenic
1201454061 Y:14148789-14148811 CAATTTTACTTCTGCGCAGAGGG - Intergenic
1201973141 Y:19817538-19817560 CAATTTTACTTCTGTGCAGAGGG + Intergenic
1202270716 Y:23071510-23071532 CCAGATTACTCCAGTTCAGATGG + Intergenic
1202295310 Y:23349172-23349194 CCAGATTACTCCAGTTCAGATGG - Intergenic
1202423711 Y:24705254-24705276 CCAGATTACTCCAGTTCAGATGG + Intergenic
1202447078 Y:24964831-24964853 CCAGATTACTCCAGTTCAGATGG - Intergenic