ID: 1066080861

View in Genome Browser
Species Human (GRCh38)
Location 10:31929024-31929046
Sequence TTGACCGCAGGCTCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066080861_1066080868 8 Left 1066080861 10:31929024-31929046 CCGGCGCGGGAGCCTGCGGTCAA No data
Right 1066080868 10:31929055-31929077 AGCACTTTGTAAACAAGGAGTGG No data
1066080861_1066080869 9 Left 1066080861 10:31929024-31929046 CCGGCGCGGGAGCCTGCGGTCAA No data
Right 1066080869 10:31929056-31929078 GCACTTTGTAAACAAGGAGTGGG No data
1066080861_1066080867 3 Left 1066080861 10:31929024-31929046 CCGGCGCGGGAGCCTGCGGTCAA No data
Right 1066080867 10:31929050-31929072 GGCTCAGCACTTTGTAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066080861 Original CRISPR TTGACCGCAGGCTCCCGCGC CGG (reversed) Intergenic
No off target data available for this crispr