ID: 1066088432

View in Genome Browser
Species Human (GRCh38)
Location 10:31994037-31994059
Sequence TGGTTGGCCTGGCTTTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066088424_1066088432 20 Left 1066088424 10:31993994-31994016 CCAAGTCCAAAAGTAGGAGGAGT No data
Right 1066088432 10:31994037-31994059 TGGTTGGCCTGGCTTTGTAGTGG No data
1066088426_1066088432 14 Left 1066088426 10:31994000-31994022 CCAAAAGTAGGAGGAGTAGGTAG No data
Right 1066088432 10:31994037-31994059 TGGTTGGCCTGGCTTTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066088432 Original CRISPR TGGTTGGCCTGGCTTTGTAG TGG Intergenic
No off target data available for this crispr