ID: 1066089354

View in Genome Browser
Species Human (GRCh38)
Location 10:32002654-32002676
Sequence CTGTCTGCACATATTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066089350_1066089354 1 Left 1066089350 10:32002630-32002652 CCTCAAATGGCTGGTGATCCTTG No data
Right 1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG No data
1066089346_1066089354 14 Left 1066089346 10:32002617-32002639 CCCTAGAGGCATTCCTCAAATGG No data
Right 1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG No data
1066089345_1066089354 21 Left 1066089345 10:32002610-32002632 CCTTTCACCCTAGAGGCATTCCT No data
Right 1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG No data
1066089348_1066089354 13 Left 1066089348 10:32002618-32002640 CCTAGAGGCATTCCTCAAATGGC No data
Right 1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066089354 Original CRISPR CTGTCTGCACATATTGAAGA GGG Intergenic
No off target data available for this crispr