ID: 1066093415

View in Genome Browser
Species Human (GRCh38)
Location 10:32049127-32049149
Sequence AATGGTTGAAAAGCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066093415_1066093417 1 Left 1066093415 10:32049127-32049149 CCTGCAACAGCTTTTCAACCATT 0: 1
1: 0
2: 2
3: 10
4: 156
Right 1066093417 10:32049151-32049173 TTTCATTTAACAAATACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066093415 Original CRISPR AATGGTTGAAAAGCTGTTGC AGG (reversed) Intronic
901077241 1:6562918-6562940 AGTGGCTGAAAAGGAGTTGCAGG + Intronic
905380355 1:37557395-37557417 AATGCTTGAACAGGTGTTTCTGG - Intronic
907652728 1:56311259-56311281 AATGGCAGAAAGGCTGTGGCTGG - Intergenic
909600824 1:77459321-77459343 AATGCTTGGAAAACTGTTACAGG - Intronic
917980446 1:180265930-180265952 AGTGTGTGAAAAGGTGTTGCTGG + Intronic
919716257 1:200780288-200780310 ACTCTTTGAAAAGCTGATGCTGG + Intronic
922868079 1:228877495-228877517 AATGTTTGATAAGCAGTTGGGGG + Intergenic
1065540038 10:26754767-26754789 TATGCTAGAAAAGCTGTTGATGG - Intronic
1066093415 10:32049127-32049149 AATGGTTGAAAAGCTGTTGCAGG - Intronic
1074074383 10:110109125-110109147 AAAGGTTGAAAACCTGTTCACGG - Intronic
1076041623 10:127254690-127254712 ATGGGTTGAAAATCTGTGGCTGG + Intronic
1076638211 10:131897096-131897118 AATAGTTAAAAATCTCTTGCTGG + Intergenic
1081953771 11:47070862-47070884 AGTGGTTGGAAAGCTGGTGTTGG - Intronic
1082246246 11:49926426-49926448 AAATGTTGAAAAACTTTTGCTGG - Intergenic
1082564042 11:54654541-54654563 AAATGTTGAAAAACTTTTGCTGG + Intergenic
1088207579 11:107412127-107412149 AAAGGTTCTAAAGCTGTGGCTGG - Intronic
1088521787 11:110709795-110709817 AATGGATGAAAAGCCACTGCAGG + Intronic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1090475777 11:127018758-127018780 AATGGATGAAAAACAGTGGCTGG + Intergenic
1092692439 12:11129032-11129054 AATAGTTGAGAAGCTGAGGCAGG - Intronic
1093843784 12:23941895-23941917 TATGTTTGAAAAGAGGTTGCAGG - Intronic
1094326828 12:29249317-29249339 ATTGCATGAAAAACTGTTGCGGG - Intronic
1094331594 12:29300074-29300096 AATGAATGAAAAGCTTTTGGTGG + Intronic
1097836598 12:64279381-64279403 TATGGTTGAAAAGCAGCTGAAGG + Intronic
1098530140 12:71532646-71532668 TCTGGTTGAAAAGGTGTTGGAGG - Intronic
1098705487 12:73684378-73684400 AAGGGTGGAAAAGGTGATGCTGG - Intergenic
1099791928 12:87346891-87346913 AAGGATTGAAAAGATGTGGCAGG + Intergenic
1104126693 12:125853607-125853629 AAGGCTTGGAAAGCTGATGCAGG + Intergenic
1105782215 13:23715352-23715374 AGTGGTAGAAAAGTTGCTGCAGG + Intergenic
1106360576 13:29026879-29026901 AATGAGTGAAAAGTTTTTGCAGG + Exonic
1106694208 13:32153748-32153770 AATGTCTGAAAAGCTGCTGCTGG - Intronic
1106786030 13:33108795-33108817 GAAAGTTGAATAGCTGTTGCAGG - Intronic
1110172833 13:72522941-72522963 CCTGGTTAAAAAGCTGGTGCTGG + Intergenic
1110342578 13:74410008-74410030 CATGTTTGAAAACCTGTTGCAGG - Intergenic
1111519579 13:89383155-89383177 GATGCTTGAGAAGCTGTTGTAGG - Intergenic
1112166442 13:96925303-96925325 AATGGTTGAACAGTTCTTACTGG + Intergenic
1113084823 13:106557651-106557673 AATGGTTGAGCTGCTGATGCAGG - Intronic
1114285208 14:21235634-21235656 AATAGCTGAAAGGCTGTTGGTGG - Intronic
1114914485 14:27245962-27245984 TAAGGTTGATAAGATGTTGCAGG + Intergenic
1115308005 14:31951765-31951787 TATGATTAAGAAGCTGTTGCAGG - Intergenic
1116484850 14:45435540-45435562 AAGTGTTAAAAAGCAGTTGCAGG + Intergenic
1116629229 14:47307774-47307796 AATAGTTGACAAGTTGTTGCTGG + Intronic
1117145815 14:52835958-52835980 AAGGCTTGAAATCCTGTTGCAGG - Intergenic
1118127350 14:62921682-62921704 AATGGTTGGGAAGTTGTTTCAGG - Intronic
1119445315 14:74658373-74658395 CATGGTTAAGAAGCTGCTGCTGG + Intronic
1121364545 14:93296134-93296156 AATGGATGAAAAGAGGCTGCTGG - Exonic
1121457538 14:94048099-94048121 AGTGGATGAAAAGGTGTGGCAGG + Exonic
1126409873 15:48362291-48362313 AATGTTTAAAAAGCAGCTGCTGG - Intergenic
1129909820 15:79217500-79217522 CATGGTTGACAAGTTGGTGCTGG + Intergenic
1132411690 15:101583650-101583672 AAGAGTTGAAAAGCTGCTACAGG - Intergenic
1132636074 16:947357-947379 GGTGGTGGAAAAGGTGTTGCAGG + Intronic
1135817597 16:25649774-25649796 TATGGTTGAGGAGCTGTTGGTGG - Intergenic
1139767505 16:69243325-69243347 AATGGCTGAAGAGCTGTGGATGG - Intronic
1141837401 16:86551056-86551078 AATGGTTGATATGGTTTTGCTGG - Intronic
1144258165 17:13490572-13490594 CCTGGTTGACCAGCTGTTGCAGG + Intergenic
1147387876 17:40092354-40092376 AATGTATGAGAAGCTGGTGCTGG + Intronic
1161769998 19:6225892-6225914 AATGAAGGAAAAGCTCTTGCTGG - Intronic
1164760875 19:30727432-30727454 AATGGTTCAACATCTGTAGCAGG + Intergenic
1165400837 19:35598977-35598999 AATGGTTGGCATCCTGTTGCAGG - Intergenic
1166869429 19:45862697-45862719 AATGGGTAAAAGGATGTTGCAGG + Intronic
927314132 2:21662583-21662605 TATGGTTGTAGGGCTGTTGCTGG + Intergenic
928400876 2:30977896-30977918 AATAGTTAGGAAGCTGTTGCAGG - Intronic
928814644 2:35277786-35277808 AATGGTTGAAAAATTGATGTGGG + Intergenic
931881128 2:66572147-66572169 AATGATTAATCAGCTGTTGCAGG + Exonic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
934523767 2:95035963-95035985 AAAGATCGAAGAGCTGTTGCTGG - Intronic
934607037 2:95703683-95703705 TATGGTTAAATAGTTGTTGCAGG + Intergenic
939061205 2:137423459-137423481 AATGGTCGCAAAGCAGTTGTAGG + Intronic
943273254 2:185835511-185835533 AAAGGTTCAAATTCTGTTGCGGG + Intergenic
944685966 2:202118057-202118079 AATGGCTGAAATCCTGTTTCAGG - Intronic
944895245 2:204157301-204157323 AATGGCTGTAAATCTGATGCAGG + Intergenic
946457958 2:219844291-219844313 AATGCTTGAAAAGCTGGAGAGGG + Intergenic
948058025 2:235023840-235023862 AATGGCTGCACAGCTGTTTCTGG + Intronic
1169989485 20:11485112-11485134 AATGTTTGACAAGTTGGTGCTGG + Intergenic
1170333464 20:15241694-15241716 AATGCTTGAGAAGCTGTTTCTGG - Intronic
1174045349 20:47729200-47729222 ACTGCTTGAGAAGCTGTGGCTGG + Intronic
1175977466 20:62718287-62718309 AATGGTTGGGAAGCTGCTGCTGG + Intronic
1178779270 21:35585529-35585551 ACTGTTTAAAAAGCTGTAGCAGG + Intronic
1179497982 21:41786633-41786655 AATGGTTGTCAAGTTGCTGCCGG + Intergenic
1181832536 22:25572888-25572910 CATGTTTGAAAAGATGTTGGGGG + Intronic
1184033715 22:41909052-41909074 AATGGGGGAAAAGCTGGAGCAGG - Intergenic
1184830180 22:46980720-46980742 AATATTTGTAAAGCTGTGGCTGG + Intronic
949487220 3:4551532-4551554 AAGGGTTGAGTAGCTGTTTCAGG + Intronic
952357061 3:32594215-32594237 AATAATTTAAAAGCTCTTGCTGG + Intergenic
952544724 3:34406663-34406685 AATGTTTGGAAAGCTGGTACAGG - Intergenic
953948799 3:47171820-47171842 AACATTTGAAAAGCTGTTTCAGG + Intergenic
957691778 3:83580167-83580189 AAGGGTTGAAACGCAGTTGGTGG - Intergenic
958713730 3:97752185-97752207 ATAGGTTTTAAAGCTGTTGCTGG - Intronic
959929942 3:111969283-111969305 AATGATTGTTAAGCTGTGGCAGG + Intronic
962088717 3:132220322-132220344 TGTGGTTGAAAAGCTAATGCTGG - Intronic
963225481 3:142857763-142857785 AATGAATGAACAGCTGTTGAAGG + Intronic
969378635 4:6779873-6779895 AGGGGTTAAAAAGCTGTGGCAGG + Intergenic
972194868 4:36641356-36641378 TATGGTTACAAAGTTGTTGCCGG - Intergenic
972218596 4:36926128-36926150 AATATTTGAAAGGCTGTTGTGGG - Intergenic
975004848 4:69271649-69271671 AATAGTTGGATGGCTGTTGCAGG - Intergenic
976411912 4:84723125-84723147 ATTGGGTCCAAAGCTGTTGCTGG - Intronic
976974264 4:91147416-91147438 TCTGGGTAAAAAGCTGTTGCTGG + Intronic
977788508 4:101069452-101069474 AAAGTTTGAAAAGGTGTTGTAGG - Intronic
978248713 4:106604949-106604971 AATGATTGACAAGCAGTTGATGG - Intergenic
983530956 4:168809392-168809414 AATGGTTGGAAAGATATTTCTGG + Intronic
983601187 4:169530690-169530712 AATGGTTGCCAAGGTGTTGGGGG + Intronic
984358068 4:178690867-178690889 AAGGGCTGAAGAGATGTTGCTGG + Intergenic
990689166 5:58343417-58343439 AATGGAAGAAAAGGTGTTGGGGG + Intergenic
992566763 5:78003831-78003853 ATTGACTGAAAAGCCGTTGCAGG + Intronic
992915109 5:81441886-81441908 ATGGGTTGAAAAACTGGTGCTGG + Intronic
992985001 5:82219653-82219675 AATGGATGTGAAGGTGTTGCTGG - Intronic
993517040 5:88850427-88850449 AATAGTTAAAAAGCAGATGCTGG - Intronic
995607377 5:113871690-113871712 AATGATTAAAAAGCTGTAGAAGG + Intergenic
996139256 5:119885717-119885739 AATGGTAGAACAGCTTTTGGGGG + Intergenic
996464814 5:123787578-123787600 AATGGATTAAGAGCAGTTGCAGG - Intergenic
997400700 5:133599692-133599714 AATGGGTGAGATGCTGGTGCTGG + Intronic
997503121 5:134394190-134394212 AATAGTTGGAAAGCTGTTCGCGG + Intergenic
998630704 5:143895111-143895133 ATTTGTTGAACAGCTGATGCAGG + Intergenic
999205810 5:149847145-149847167 AATGGACGAGAAGCTGTTGGGGG + Intronic
999300588 5:150487746-150487768 AATGGTCCAAGTGCTGTTGCTGG + Intronic
1000529648 5:162403609-162403631 TATGTTTGAAAGCCTGTTGCAGG - Intergenic
1001010073 5:168089429-168089451 AATAGATGAAATGCTGTAGCAGG - Intronic
1001834677 5:174821962-174821984 ACAGGTTCAAAAGGTGTTGCAGG - Intergenic
1003982977 6:11406939-11406961 AATGGTTGAGAGGCTGAGGCAGG - Intergenic
1006288284 6:33114532-33114554 AATGGTTGAAAAGTGTTTGTTGG - Intergenic
1007205267 6:40144886-40144908 CATGGTTGATCAGCTGTTGCTGG - Intergenic
1008033409 6:46721446-46721468 AATAATTGGAAGGCTGTTGCTGG - Intronic
1008397411 6:51025107-51025129 ACTGGTTTGAAAGCTTTTGCTGG - Intergenic
1010500116 6:76588301-76588323 TATGGCTGGAAAGCTGATGCTGG + Intergenic
1011899330 6:92272628-92272650 AATGGATGAAAAACTGTTGGTGG + Intergenic
1012035844 6:94138018-94138040 AATTGTTTAAAACATGTTGCAGG + Intergenic
1012320201 6:97834587-97834609 AATAGTTTAAAAGCTGTTCAAGG + Intergenic
1012370890 6:98505727-98505749 AATTGTTCAAAAGCAGTTCCAGG + Intergenic
1012392551 6:98758994-98759016 AATGGTTTAAAAACTGTTACAGG + Intergenic
1016913440 6:149222100-149222122 AATGGCTGAATGGCTGTTCCGGG - Intronic
1020547983 7:9557894-9557916 AATTGTTGAAAAGCTCTGTCAGG - Intergenic
1021107602 7:16656225-16656247 AAAGGTTGAAGAACTGTTCCAGG - Intronic
1021199303 7:17710502-17710524 CAGGGATGAAAGGCTGTTGCTGG - Intergenic
1023530033 7:41143526-41143548 ATTGGTTTAAAAGCCATTGCCGG + Intergenic
1023840732 7:44096217-44096239 AATGTGTGACAAACTGTTGCAGG + Intergenic
1025050551 7:55730573-55730595 ATTGGTAGAAATGCTATTGCTGG - Intergenic
1025748243 7:64266292-64266314 AAGGGTTGAAGAGCAGTTGAAGG - Exonic
1028104753 7:86863946-86863968 AATGGTTAAAATGCTATTGTAGG - Intronic
1028797812 7:94924912-94924934 GATGGTTGAAAGTCTGTAGCTGG + Intronic
1031115646 7:117665292-117665314 CATGGTTGAAAAGCTGATTGTGG + Intronic
1031189111 7:118523787-118523809 ATTTGTTGAAAATCTGTTGGTGG + Intergenic
1033523575 7:142186975-142186997 AATGGAGGGAAAGCTGTAGCTGG + Intronic
1036764339 8:11537757-11537779 CATGGTTGAAAAGCACTTGACGG - Intronic
1037468375 8:19183421-19183443 AATGGCAGACAAGTTGTTGCTGG - Intergenic
1038959976 8:32508086-32508108 AATGGTTGAAAAGTGTTAGCTGG - Intronic
1039704225 8:39990554-39990576 AATGTTGGAAAGGCAGTTGCTGG - Intronic
1041142365 8:54836204-54836226 AAAGGGAGAAAAGATGTTGCAGG + Intergenic
1041794745 8:61735549-61735571 AATGGTGGAAATTCTGTTTCAGG + Intergenic
1042019574 8:64356924-64356946 AATGGATGAAAAATTCTTGCTGG - Intergenic
1044324525 8:90844599-90844621 AGTGGTGGAAATGATGTTGCGGG - Intronic
1046483943 8:114860538-114860560 AATAGTTCTAAAGCAGTTGCAGG - Intergenic
1046618451 8:116502325-116502347 GATGGTTGATAAGCTGGTGCAGG - Intergenic
1048081065 8:131127636-131127658 AATGGTTGAAATACGGCTGCTGG + Intergenic
1048952280 8:139506198-139506220 AATGGTCGAACTGCTGTTGCTGG + Intergenic
1051138144 9:13947885-13947907 AATGGTTGAAAATCTTTTCAAGG + Intergenic
1053166609 9:35848375-35848397 GCTGGTAGAACAGCTGTTGCTGG - Intronic
1054792345 9:69267913-69267935 AATGGTTAAAATGCTCTTTCTGG + Intergenic
1054904234 9:70400791-70400813 AAAGCTTGAAAAGCTGCTGGTGG - Intronic
1057448789 9:95138048-95138070 AAAGGCTGAAAAGCAGTGGCTGG + Intronic
1057537544 9:95928081-95928103 AATGATTTAAAAGCTGCTGAAGG - Exonic
1186925288 X:14326997-14327019 AGTGGTTGAAAACCTGTTGCTGG - Intergenic
1188155906 X:26742847-26742869 AATGGTTGAAAAGCATATACAGG + Intergenic
1189567949 X:42263096-42263118 AATAGTTGCAATGCTTTTGCTGG + Intergenic
1190135565 X:47793884-47793906 AATGAATGAAAAGCTGTTGCAGG - Intergenic
1191758617 X:64623207-64623229 AAAGCTTGAAGAGCTGATGCAGG - Intergenic
1193870335 X:86789304-86789326 AAAGATTGAATACCTGTTGCTGG - Intronic
1198638057 X:138722213-138722235 AGTGGTTCAAAAGCTTTTGGAGG - Intronic
1201852989 Y:18508672-18508694 AATGGCAGCAAAGTTGTTGCAGG - Intergenic
1201880332 Y:18811712-18811734 AATGGCAGCAAAGTTGTTGCAGG + Intronic