ID: 1066099147

View in Genome Browser
Species Human (GRCh38)
Location 10:32102013-32102035
Sequence CTGTTGTTGCATGTGACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066099147_1066099151 10 Left 1066099147 10:32102013-32102035 CCAGTGGTCACATGCAACAACAG No data
Right 1066099151 10:32102046-32102068 AGTTTAACAATCACTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066099147 Original CRISPR CTGTTGTTGCATGTGACCAC TGG (reversed) Intergenic
No off target data available for this crispr