ID: 1066101655

View in Genome Browser
Species Human (GRCh38)
Location 10:32123084-32123106
Sequence GAGCCTCATCCCTTCTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066101655_1066101665 24 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101655_1066101659 1 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data
1066101655_1066101663 16 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101663 10:32123123-32123145 CCCACGGGCTCCACAGAGCAAGG No data
1066101655_1066101658 0 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101658 10:32123107-32123129 CCACTTGTTCCCAGCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066101655 Original CRISPR GAGCCTCATCCCTTCTAAGT TGG (reversed) Intergenic