ID: 1066101659

View in Genome Browser
Species Human (GRCh38)
Location 10:32123108-32123130
Sequence CACTTGTTCCCAGCTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066101648_1066101659 18 Left 1066101648 10:32123067-32123089 CCCAGGAAGCTCTCACCCCAACT No data
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data
1066101653_1066101659 3 Left 1066101653 10:32123082-32123104 CCCCAACTTAGAAGGGATGAGGC No data
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data
1066101655_1066101659 1 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data
1066101649_1066101659 17 Left 1066101649 10:32123068-32123090 CCAGGAAGCTCTCACCCCAACTT 0: 2
1: 0
2: 7
3: 39
4: 218
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data
1066101654_1066101659 2 Left 1066101654 10:32123083-32123105 CCCAACTTAGAAGGGATGAGGCT No data
Right 1066101659 10:32123108-32123130 CACTTGTTCCCAGCTCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066101659 Original CRISPR CACTTGTTCCCAGCTCCCAC GGG Intergenic
No off target data available for this crispr