ID: 1066101665

View in Genome Browser
Species Human (GRCh38)
Location 10:32123131-32123153
Sequence CTCCACAGAGCAAGGAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066101661_1066101665 -9 Left 1066101661 10:32123117-32123139 CCAGCTCCCACGGGCTCCACAGA No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101656_1066101665 2 Left 1066101656 10:32123106-32123128 CCCACTTGTTCCCAGCTCCCACG No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101655_1066101665 24 Left 1066101655 10:32123084-32123106 CCAACTTAGAAGGGATGAGGCTC No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101657_1066101665 1 Left 1066101657 10:32123107-32123129 CCACTTGTTCCCAGCTCCCACGG No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101653_1066101665 26 Left 1066101653 10:32123082-32123104 CCCCAACTTAGAAGGGATGAGGC No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101660_1066101665 -8 Left 1066101660 10:32123116-32123138 CCCAGCTCCCACGGGCTCCACAG No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data
1066101654_1066101665 25 Left 1066101654 10:32123083-32123105 CCCAACTTAGAAGGGATGAGGCT No data
Right 1066101665 10:32123131-32123153 CTCCACAGAGCAAGGAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066101665 Original CRISPR CTCCACAGAGCAAGGAGCGC TGG Intergenic
No off target data available for this crispr