ID: 1066101950

View in Genome Browser
Species Human (GRCh38)
Location 10:32125296-32125318
Sequence TGCTGTCTGTTCCACTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066101950_1066101951 2 Left 1066101950 10:32125296-32125318 CCAGTGTAGTGGAACAGACAGCA No data
Right 1066101951 10:32125321-32125343 CTAGACATTTCCATGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066101950 Original CRISPR TGCTGTCTGTTCCACTACAC TGG (reversed) Intergenic
No off target data available for this crispr