ID: 1066114556

View in Genome Browser
Species Human (GRCh38)
Location 10:32227989-32228011
Sequence GGTGGTGCCCACCCAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066114553_1066114556 -4 Left 1066114553 10:32227970-32227992 CCACACTGGCAACCGATTAGGTG No data
Right 1066114556 10:32227989-32228011 GGTGGTGCCCACCCAGATAGAGG No data
1066114550_1066114556 12 Left 1066114550 10:32227954-32227976 CCTGCTTTTATTCTAGCCACACT No data
Right 1066114556 10:32227989-32228011 GGTGGTGCCCACCCAGATAGAGG No data
1066114549_1066114556 22 Left 1066114549 10:32227944-32227966 CCATCTTCTTCCTGCTTTTATTC No data
Right 1066114556 10:32227989-32228011 GGTGGTGCCCACCCAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066114556 Original CRISPR GGTGGTGCCCACCCAGATAG AGG Intergenic