ID: 1066118809

View in Genome Browser
Species Human (GRCh38)
Location 10:32263767-32263789
Sequence ACGAACCCTGCTTTTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066118805_1066118809 17 Left 1066118805 10:32263727-32263749 CCACACTCTCATGGGGACTTGTC No data
Right 1066118809 10:32263767-32263789 ACGAACCCTGCTTTTTTTTCTGG No data
1066118804_1066118809 18 Left 1066118804 10:32263726-32263748 CCCACACTCTCATGGGGACTTGT No data
Right 1066118809 10:32263767-32263789 ACGAACCCTGCTTTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066118809 Original CRISPR ACGAACCCTGCTTTTTTTTC TGG Intergenic
No off target data available for this crispr