ID: 1066119260

View in Genome Browser
Species Human (GRCh38)
Location 10:32267927-32267949
Sequence GGTCAAATATTTCCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066119257_1066119260 -2 Left 1066119257 10:32267906-32267928 CCATTCTCTTCACAGAAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 318
Right 1066119260 10:32267927-32267949 GGTCAAATATTTCCAAAGGAAGG 0: 1
1: 0
2: 0
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066119260 Original CRISPR GGTCAAATATTTCCAAAGGA AGG Intronic
902969823 1:20039259-20039281 GGTCAACTATGGCCAAAGCATGG + Intronic
905010735 1:34745439-34745461 GGTAAAAGACTTCCTAAGGAAGG - Intronic
907668341 1:56452510-56452532 AGCCAAATATTTCCAGAGGCAGG + Intergenic
911692414 1:100849384-100849406 GCTAAAATATTTCCAGAAGAGGG - Intergenic
913458457 1:119058249-119058271 GGTCAAATATTTTCAATGAAGGG - Intronic
915650002 1:157302764-157302786 GATCAAATATTTCTGAAGGGGGG + Intergenic
915661521 1:157409441-157409463 GATCAAATATTTCTGAAGGGAGG - Intergenic
916999866 1:170345873-170345895 GGTGAAATAATGCCAAAGTAAGG + Intergenic
917216086 1:172679422-172679444 GGTGAAATATCCCCAGAGGAAGG + Intergenic
922470727 1:225875571-225875593 GGTGACATATTTTCAAAGGCAGG + Intronic
1064344720 10:14521702-14521724 GGTCAAATATGTTCAAGGCAGGG - Intronic
1066119260 10:32267927-32267949 GGTCAAATATTTCCAAAGGAAGG + Intronic
1070160195 10:73862104-73862126 GGTCAATTCCTTCCACAGGAAGG + Intronic
1070435756 10:76391011-76391033 GGGAAAATATTTCCATTGGATGG - Intronic
1070532437 10:77348849-77348871 GGGCATATCTTTGCAAAGGAAGG + Intronic
1070684348 10:78469808-78469830 GGACATATATTGCCAAATGAGGG - Intergenic
1076035084 10:127193419-127193441 GGTCAGATATTTACGTAGGAGGG - Intronic
1077715879 11:4580057-4580079 GGGCAAATAATGACAAAGGAGGG + Intergenic
1083056780 11:59829440-59829462 TATCAAACATCTCCAAAGGATGG - Exonic
1086570423 11:88277611-88277633 GTTTAAATATCTCCAAAGCACGG + Intergenic
1087336418 11:96850417-96850439 AGTCAAATAGTTCCCAAGCATGG + Intergenic
1087371178 11:97286851-97286873 GGCCAAATATTTGTAAAGGTCGG - Intergenic
1087896357 11:103590706-103590728 GGTCAATCATTCCAAAAGGAAGG - Intergenic
1087961219 11:104352462-104352484 ATTCAAATATTTCCAAAAGAAGG - Intergenic
1088026678 11:105193599-105193621 GGACAAATCTTTCAAAAGAAGGG + Intergenic
1088263039 11:107962868-107962890 GGACAAACATTTCCAGAGAATGG - Exonic
1088458695 11:110060036-110060058 CCTCAAATATTTCCAAAAGATGG - Intergenic
1092486406 12:8906197-8906219 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1093500513 12:19806549-19806571 GATTACATATTTCCAAAGAAAGG - Intergenic
1097663438 12:62454972-62454994 GGTCCAATATCTCCAAAAAATGG + Intergenic
1098701443 12:73632853-73632875 GGTCAAATCCTTCCAGGGGATGG + Intergenic
1101479072 12:105079433-105079455 GATAAAATATTTTAAAAGGAGGG + Intronic
1102899746 12:116627196-116627218 GGTCAAATATCTCTACACGAGGG + Intergenic
1103213503 12:119183781-119183803 GCTCCAAGATTTCCAAAAGAGGG - Intronic
1104258344 12:127160183-127160205 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1104297120 12:127526495-127526517 GGTAAACTGCTTCCAAAGGAAGG - Intergenic
1106091141 13:26595316-26595338 GGTTTAATATTTAAAAAGGAAGG - Intronic
1107518285 13:41153426-41153448 GGTTAAATGTTTCAAAATGAAGG + Intergenic
1108984498 13:56568122-56568144 TGTAAAATAATTCCAAAGGTAGG + Intergenic
1109285075 13:60399016-60399038 AGACTAATCTTTCCAAAGGAGGG - Intronic
1110164664 13:72425705-72425727 GGACAAATATTCCCAAAAGGAGG + Intergenic
1111157631 13:84349355-84349377 GGTTAAATATAACCTAAGGAAGG + Intergenic
1112209310 13:97359525-97359547 GGATAAACATTTCCAAAGCAAGG + Intronic
1114793734 14:25688184-25688206 GCTCAAATATTTCCCACAGAAGG - Intergenic
1116577008 14:46587667-46587689 GGCCAAATAGTACCAAAGGAGGG + Intergenic
1116908338 14:50429430-50429452 GGACAAATATGTCCTAAGCATGG + Intronic
1117046609 14:51818833-51818855 GGTCAACTATTTACATGGGAAGG + Intergenic
1117300767 14:54424640-54424662 TGTCAAATATTTACATAGAAAGG - Exonic
1117474698 14:56082158-56082180 GATGAAAAATTCCCAAAGGAAGG + Intergenic
1117818585 14:59623939-59623961 GGTGAAATATTTCTGAAGAAAGG + Intronic
1118100207 14:62590898-62590920 GGTCAAATATGACCTTAGGATGG - Intergenic
1119941033 14:78641757-78641779 TGTTAAATATTTGCAAAGGAAGG + Intronic
1120232501 14:81855606-81855628 GGCCAAATAGTACCAAAGGAAGG + Intergenic
1122563081 14:102631016-102631038 GGGCAAACATTCCCAGAGGAAGG + Intronic
1126400100 15:48259539-48259561 TGACAAATATTTCCAAATGATGG + Intronic
1128320444 15:66690048-66690070 GGTGAGATAATTCCAAATGAGGG - Intergenic
1131277817 15:90996753-90996775 GGTCATATATTTCTACTGGATGG + Intergenic
1132400814 15:101503888-101503910 GATTAAATGTTTCCAAAGAATGG + Intronic
1133734946 16:8607804-8607826 GGACAAAACTGTCCAAAGGATGG + Intergenic
1134910902 16:18025478-18025500 GGTCACATTTTCCCAAAGTATGG + Intergenic
1136734229 16:32449224-32449246 GTTCCAATATTGCTAAAGGAGGG - Intergenic
1142543494 17:680475-680497 GGTTAAATATTTTAAAAAGAAGG + Intronic
1145386726 17:22419086-22419108 GGTAAAATATTCCCACAGGTAGG + Intergenic
1145746184 17:27321606-27321628 GGGCAAATGATACCAAAGGATGG + Intergenic
1146576209 17:33994086-33994108 GATGAAATATTTGCAAAGCAGGG - Intronic
1147490205 17:40858969-40858991 GGTAAAAAATTTCCAAGAGAAGG + Intergenic
1153165545 18:2257317-2257339 GGTCAAATAATACCAATGGTTGG + Intergenic
1155369467 18:25082444-25082466 GGGCAAATATTTCCAACCCAGGG + Intronic
1156052733 18:32956946-32956968 GGATAAATATTTCTAAAGGAAGG + Intronic
1157013534 18:43681749-43681771 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1157076670 18:44474407-44474429 GTGGAAATATTTCCAAGGGAGGG - Intergenic
1157165644 18:45356158-45356180 GGTCCAAAAATTCAAAAGGATGG + Intronic
1159771656 18:72552999-72553021 AAACAAATATTTCCAAAGTAAGG - Intronic
1164922369 19:32098205-32098227 GGACAAATATTTCAAAATAAAGG + Intergenic
1167286730 19:48602512-48602534 GATCAAATATTTGCCAAGGGAGG + Intronic
925101659 2:1251979-1252001 GTTTAAAGATTTCCAAAGGGAGG + Intronic
926173075 2:10565859-10565881 GATCAAATATTTCAAAATAATGG + Intergenic
926555006 2:14347307-14347329 GGTCAAAGACTCCCAAAGGCGGG + Intergenic
927051690 2:19336585-19336607 GATCAAATTTTTCCAAATGAAGG + Intergenic
928600408 2:32898865-32898887 GGTAAAGTATTTCTAGAGGAGGG - Intergenic
930361895 2:50391034-50391056 GGTAAAACATTTCCAAAGTCTGG - Intronic
930811158 2:55542718-55542740 GTTCAAATAATTCCTGAGGAGGG - Intronic
930898668 2:56476797-56476819 AGTCAAGTGTTTCCAGAGGAAGG - Intergenic
932254777 2:70275130-70275152 GGTCAATTATGGCCAAAGCACGG + Exonic
932830190 2:74981919-74981941 GATCAAATATATCTAAAAGAAGG + Intergenic
937831850 2:126433108-126433130 GGCCCAATATGTCCCAAGGAAGG + Intergenic
941322661 2:164074614-164074636 GGTGAAATATTTCAAAAAGGGGG + Intergenic
942337005 2:174899411-174899433 GGTCAAAGATTTGCCAAAGATGG + Intronic
942383169 2:175414467-175414489 TGTCAAATGTTTTCCAAGGATGG + Intergenic
942942119 2:181630924-181630946 GTTCCAATATTTCCAAATGTGGG + Intronic
943642756 2:190377029-190377051 GGTCAAGTATTTCTAAAAGCAGG + Intergenic
943647796 2:190426657-190426679 TGTCTATTATTTCCAAATGATGG + Intronic
944966410 2:204939361-204939383 GGTTATATATTTCCAAGGGGAGG + Intronic
945700096 2:213159041-213159063 GGTTGAATATTTAAAAAGGAAGG + Intergenic
946155126 2:217802119-217802141 GATGAGATATTTACAAAGGAAGG + Exonic
946541814 2:220693049-220693071 GGTCAGATATATTCAAGGGAAGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169096482 20:2903768-2903790 TGTGAAATATTTTTAAAGGAAGG + Intronic
1170007966 20:11689429-11689451 GGTGAATTATTTCCAAATGAGGG - Intergenic
1171348878 20:24487682-24487704 GGCCAAATATTCCAGAAGGAAGG - Intronic
1173233062 20:41217521-41217543 GGTCAGCATTTTCCAAAGGAAGG - Intronic
1174531302 20:51216636-51216658 GGCCAAATATTTCCAGAAAATGG - Intergenic
1174990872 20:55507870-55507892 GGTCAAATATTTCCTAAATTTGG + Intergenic
1177931085 21:27284755-27284777 GGAGAAATATTTTAAAAGGAAGG - Intergenic
1178438331 21:32578800-32578822 GGTGAAATTTTTCCAAAAGCAGG + Exonic
1183999592 22:41663326-41663348 TGTAAAAGATTTTCAAAGGAAGG + Intronic
949213978 3:1542601-1542623 TGTCAATTATTTCCAAATGTGGG - Intergenic
951339843 3:21471596-21471618 GATCAAAAATTCCCAGAGGATGG + Intronic
951479793 3:23148228-23148250 GCTCAGATTTTTCCAAATGATGG - Intergenic
951619029 3:24580469-24580491 ATTCAACTATTTCTAAAGGAGGG + Intergenic
957882266 3:86234016-86234038 GGACAAATACATACAAAGGAAGG - Intergenic
958046314 3:88288025-88288047 GGTATAATATTTCCAAACAATGG + Intergenic
958195916 3:90242904-90242926 GGTCAAATATTTGCAGAGTTTGG + Intergenic
958419097 3:93911533-93911555 GGTCAAATATTTGCAGAGTTTGG + Intronic
959801085 3:110495805-110495827 GGACAAAAGCTTCCAAAGGAAGG + Intergenic
960155595 3:114294601-114294623 AGTCAAATATTTCTGAGGGAGGG + Intronic
960738110 3:120802751-120802773 GTTCAGATAATTCCTAAGGAAGG - Intergenic
961756513 3:129130333-129130355 GTTCAAATGTTTCCAATGGGAGG - Intronic
962412503 3:135153536-135153558 GGTCAGAGTTTTCCAAATGAGGG - Intronic
963090856 3:141482488-141482510 GGCAAAATAGTTCAAAAGGAGGG + Intergenic
963659978 3:148113022-148113044 GGTGAGATAGTTGCAAAGGATGG + Intergenic
965289601 3:166862269-166862291 GGTAAAATATTTGCAGAGGCAGG + Intergenic
965680262 3:171243351-171243373 GGTCAAGTTTTTACAAAGAAAGG + Intronic
965978483 3:174656739-174656761 AGTAAAAAATTTCTAAAGGAGGG - Intronic
969930073 4:10622272-10622294 GGTCATATAGTTTTAAAGGAGGG + Intronic
971660760 4:29411822-29411844 GGTAACATTTTTCCAAATGAAGG + Intergenic
971691055 4:29836676-29836698 GGTCAAAAATCCCAAAAGGAGGG - Intergenic
973741272 4:53921807-53921829 GTTCAAATACTACCACAGGAAGG + Intronic
974716343 4:65672364-65672386 GGATAAATATTTCCAGAGGTGGG - Intergenic
978776736 4:112512746-112512768 GGTCAAAAATGACCAAATGAAGG - Intergenic
979312165 4:119215968-119215990 AGTAAAAAACTTCCAAAGGAAGG - Intronic
980302630 4:131014014-131014036 GGCCAAACAGTACCAAAGGAGGG + Intergenic
982114040 4:152082372-152082394 GGTCATTTATTTCCACAGGAGGG + Intergenic
982255929 4:153451810-153451832 GGGAAAATAATTTCAAAGGAGGG + Intergenic
983120010 4:163871798-163871820 GATCAAATATTAACAAATGAAGG - Intronic
986303016 5:6493393-6493415 GGAAAAATATATCCAAAGGCAGG + Exonic
986588121 5:9340104-9340126 GGTGAAAAATTTCCAATGGTAGG + Intronic
986703119 5:10430892-10430914 GGTCAAATATTATCCCAGGAAGG - Intronic
987842271 5:23237098-23237120 GGTCAAACAGTACCAAAGGAGGG + Intergenic
989269404 5:39514367-39514389 GGTCAAGTAAATCCAAAGAAAGG - Intergenic
992155504 5:73951620-73951642 GGTGATCGATTTCCAAAGGAGGG - Intergenic
993595249 5:89846537-89846559 GGGTAAAGATTTCCAAATGATGG - Intergenic
995324047 5:110872057-110872079 GCTTAAATATTCCCAAAGGCAGG + Intergenic
995681042 5:114719810-114719832 GATCAAATATTACTAAAGAAGGG + Intergenic
996995501 5:129691885-129691907 GGTTAAATATTTTCTGAGGATGG + Intronic
997280721 5:132643061-132643083 GGTCAGAGCTTTCCAAAGGTGGG - Exonic
1002938887 6:1698811-1698833 GGGCACATATTTCCTCAGGAAGG + Intronic
1003571966 6:7261799-7261821 GGTCAACTTTTTCCAAGGGCAGG - Intergenic
1006193263 6:32222291-32222313 GTTAAAATATTTCCAAATTAAGG - Intronic
1007120673 6:39377983-39378005 GATCAACAAGTTCCAAAGGATGG - Intronic
1008078146 6:47167481-47167503 AGTCAAGTCTTTCCTAAGGAAGG - Intergenic
1008939849 6:57034877-57034899 GGAAAAATATTTCAAAAAGAAGG - Intergenic
1015139801 6:129917138-129917160 AGTCCAATATTTCCAATTGATGG - Intergenic
1018467727 6:164066539-164066561 GGTGAAAAATTTCCCAAGGGAGG + Intergenic
1018513611 6:164554235-164554257 GGTTAAATGCTTCCAAAGAATGG - Intergenic
1018794731 6:167177006-167177028 GGTGAAATTTTTCCAAAAGCAGG - Exonic
1022780188 7:33573977-33573999 GGTAGAATATTTAAAAAGGAAGG + Intronic
1022848800 7:34238598-34238620 GGGCAAATATTTGCAAAAAATGG + Intergenic
1025013915 7:55423482-55423504 GACCAAATATTTCCTTAGGATGG + Intronic
1025286470 7:57666375-57666397 AGTCAAGTATTTTCAAAGTAAGG + Intergenic
1027816875 7:82985352-82985374 GGTCAAATTTTTCTAAAGCTTGG - Intronic
1028012691 7:85668361-85668383 GCTGAAAAATTTCCAAATGAAGG - Intergenic
1028082203 7:86591652-86591674 GATTAAATATTTCTAAAGTATGG + Intergenic
1028309023 7:89306293-89306315 GGTCAAATACTTCATAAGGAAGG + Intronic
1028906619 7:96161435-96161457 GGTCATAGATTTGGAAAGGAAGG - Intronic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031494931 7:122434316-122434338 GGTCAAATATTGAAAAAGGTAGG + Intronic
1033723150 7:144083838-144083860 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1036424893 8:8635696-8635718 AGTCAAGTATTTCCATGGGAGGG + Intergenic
1037636403 8:20704364-20704386 GGTCAACCATTTCCAAAGGGTGG - Intergenic
1038806492 8:30797626-30797648 TGTAAAATATTTCCAAACGTTGG + Exonic
1041327067 8:56679261-56679283 GGAAAAAGATTTTCAAAGGAAGG + Intergenic
1043578178 8:81681557-81681579 TGTCAAATATTTTCAGAAGATGG - Exonic
1044342283 8:91060189-91060211 GGTCAGATATCTCCATAGGTAGG - Intergenic
1044375305 8:91463403-91463425 AGTCAAATACTTCCAAAGTAGGG - Intergenic
1044708550 8:95032550-95032572 TGTCTAAGAATTCCAAAGGAAGG + Intronic
1046154589 8:110270908-110270930 GCTCAAATATTACCTTAGGAAGG + Intergenic
1046680937 8:117169418-117169440 GGTTAAATTTTTCAAAAGGAGGG + Intronic
1048077257 8:131085080-131085102 GGTTAAATATCTCCATAGGTAGG - Intergenic
1050233744 9:3556375-3556397 GGGCAAATATCTCCTGAGGAAGG + Intergenic
1050396280 9:5200387-5200409 GATCAAGTATTTGCAAATGATGG - Intergenic
1050768937 9:9172529-9172551 GTGCAAATATTTCCAAAACATGG - Intronic
1051433421 9:17004467-17004489 TGTCAACTCTTTCCAAAAGACGG - Intergenic
1053145462 9:35708945-35708967 CGTCAGATATTTGGAAAGGAAGG + Intronic
1053227327 9:36371784-36371806 TGTCTAATATTTCCAGAAGAAGG - Intronic
1054788189 9:69229776-69229798 GCTAAAATTCTTCCAAAGGAAGG - Intronic
1054993169 9:71353729-71353751 TGCCAAATATTTACAAAAGAAGG - Intronic
1056247247 9:84707939-84707961 GGGGAAATGTTTTCAAAGGAAGG + Intronic
1056908631 9:90677135-90677157 GGGCAAAAATTTCCACAGGTTGG + Intergenic
1057632080 9:96727646-96727668 AGTCAAATGTTTCCAAAAAATGG - Intergenic
1058656412 9:107225648-107225670 TGACAAAAATTTCCAAAAGAGGG + Intergenic
1058845156 9:108950065-108950087 TGTAAAATATTCCCAAATGAAGG - Intronic
1059312212 9:113396471-113396493 GGGCCAATATTTCCTTAGGAAGG + Intronic
1187306073 X:18096477-18096499 GGTCATATATCTCCTTAGGATGG + Intergenic
1188357505 X:29210446-29210468 GTTCAAATATATCTTAAGGAAGG + Intronic
1188624703 X:32269150-32269172 AGTCAAGTGTTTCCAGAGGAAGG - Intronic
1190409284 X:50118853-50118875 GATAAAATATTTGCAAAGTACGG - Intergenic
1191842394 X:65522549-65522571 AGTCAGATATGGCCAAAGGATGG + Intronic
1193182920 X:78479945-78479967 TGTGAATTATTTGCAAAGGAGGG + Intergenic
1193508244 X:82369774-82369796 GGTCAAACATTGCCAAAAGAGGG + Intergenic
1193750695 X:85339686-85339708 TCTGAAAAATTTCCAAAGGAGGG - Intronic
1194350854 X:92824106-92824128 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1195145971 X:102017935-102017957 GGGCAAATATTTTCAAATGAGGG + Intergenic
1195522151 X:105843553-105843575 AGATAAATATTTCCAAAGGATGG + Intronic
1197730358 X:129804558-129804580 GATCAAATATTTCCAAGGGGGGG + Exonic
1197923849 X:131626097-131626119 TGTCAAATATTTCCAACATATGG + Intergenic
1198251985 X:134888463-134888485 GGTCTAAGAGTTCTAAAGGAAGG - Exonic
1200659179 Y:5940789-5940811 GGCCAAACAGTACCAAAGGAGGG + Intergenic
1201321389 Y:12701757-12701779 GGTCAGATACTTCCACTGGAGGG + Exonic