ID: 1066125456

View in Genome Browser
Species Human (GRCh38)
Location 10:32337423-32337445
Sequence AGGGACACCCTGTGAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066125453_1066125456 19 Left 1066125453 10:32337381-32337403 CCTCATGGACAGGATCAGATCAG No data
Right 1066125456 10:32337423-32337445 AGGGACACCCTGTGAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066125456 Original CRISPR AGGGACACCCTGTGAATATC TGG Intronic
No off target data available for this crispr