ID: 1066128690

View in Genome Browser
Species Human (GRCh38)
Location 10:32368332-32368354
Sequence GAGTAGGCTATGATGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066128690_1066128691 -9 Left 1066128690 10:32368332-32368354 CCTCTGCACATCATAGCCTACTC 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1066128691 10:32368346-32368368 AGCCTACTCTCTATCCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066128690 Original CRISPR GAGTAGGCTATGATGTGCAG AGG (reversed) Intronic
903546283 1:24125380-24125402 GAGTAGGATATGAGGTGAGGTGG + Intronic
919032546 1:192261789-192261811 GAGCAGGCTATGTTATGCTGTGG - Intergenic
922213607 1:223503525-223503547 GAGTTGCCTGTGATGGGCAGGGG - Intergenic
922790558 1:228308643-228308665 GAGTGGGCTATGGTTTGAAGTGG - Intronic
1064520213 10:16193008-16193030 GTTTAGGCTATGATGGGAAGGGG + Intergenic
1064957521 10:20927241-20927263 TAGTCGGCTATGATGTTCTGTGG - Intronic
1066128690 10:32368332-32368354 GAGTAGGCTATGATGTGCAGAGG - Intronic
1066440948 10:35437958-35437980 GAGTAGGCTGTGGGGTGAAGGGG - Intronic
1070256468 10:74817083-74817105 GGGAAGGCTATGAAATGCAGGGG + Intergenic
1070564241 10:77591337-77591359 GAGTAGGGTAGGATTTTCAGAGG - Intronic
1071725487 10:88194195-88194217 GAGAAGGCTTTGTTGTGGAGGGG + Intergenic
1075908874 10:126106267-126106289 GAGGAGGCTGAGATGGGCAGAGG - Intronic
1075935911 10:126341037-126341059 GAGTAGGGTATTCTATGCAGAGG - Intronic
1076081663 10:127587296-127587318 GAGAAGGCTATGTTTTCCAGTGG + Intergenic
1082775569 11:57241982-57242004 TAGTGGGCTATGATGTGCATTGG + Intergenic
1083994404 11:66265105-66265127 GGGGAGGCTGGGATGTGCAGAGG + Intronic
1087396238 11:97603205-97603227 GAGTATGCTATGTGCTGCAGTGG - Intergenic
1092192372 12:6530275-6530297 GGGAAGGCTGTGATGTGTAGGGG - Intronic
1098009935 12:66040257-66040279 GAGGAGGCTAGAATTTGCAGGGG - Intergenic
1110511087 13:76351483-76351505 AAGTAGGCTATAATATCCAGGGG + Intergenic
1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG + Intergenic
1111608628 13:90575332-90575354 GAGTAGGATATGATATTAAGTGG - Intergenic
1114751987 14:25215086-25215108 GAGAGGGCTATTATGTGCAGGGG + Intergenic
1119080936 14:71692878-71692900 GGGTAGGCTGTGCTGTCCAGGGG + Intronic
1119711590 14:76826504-76826526 GAGTAGGCTTTGATGGGAATTGG - Exonic
1123771042 15:23529577-23529599 AAGTTGGCTATGATTTGAAGGGG - Intergenic
1124652674 15:31484907-31484929 GAGTGGGCTCTGATCTGCTGCGG + Intronic
1128374078 15:67063476-67063498 GAGTGGGCAAAGATGGGCAGGGG - Intergenic
1130730377 15:86486070-86486092 GAGGAGACTAAGCTGTGCAGAGG - Intronic
1133182304 16:4066132-4066154 GAATAGTCTATGATGGGCAATGG + Intronic
1133639893 16:7706675-7706697 AAATAGGATATGAAGTGCAGAGG - Intronic
1135390535 16:22089561-22089583 GAGTACTCTAAGTTGTGCAGAGG + Intergenic
1136683770 16:31982467-31982489 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1136784398 16:32926023-32926045 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1136885385 16:33927783-33927805 GAGCAGGCTCTGATGTGGAGTGG - Intergenic
1138062785 16:53909332-53909354 GAATAAGGCATGATGTGCAGTGG + Intronic
1138064291 16:53924592-53924614 GAGTAGACTATGAAGGGCGGGGG + Intronic
1139697023 16:68682327-68682349 CAGTGGGCCATGAGGTGCAGAGG + Exonic
1140775207 16:78243051-78243073 GAGGAGGCTAGGATGGGGAGAGG - Intronic
1142255144 16:89010310-89010332 GATGAGGCCATGATGGGCAGTGG + Intergenic
1203087057 16_KI270728v1_random:1190029-1190051 GAGCAGGCTCTGATGTGGAGTGG + Intergenic
1146138156 17:30341247-30341269 GAGTCTGCTTTGAAGTGCAGTGG + Intergenic
1149199764 17:54170121-54170143 GAGTATGTTATTATATGCAGAGG + Intergenic
1149435053 17:56626742-56626764 GAGCAGGCAAAGAGGTGCAGAGG + Intergenic
1151433759 17:74081671-74081693 GAGTTGGCTATACTGGGCAGTGG - Intergenic
1154429994 18:14301176-14301198 GAGAAGGATATGATATTCAGGGG + Intergenic
1155907021 18:31463845-31463867 CTTTAGGCTATGAGGTGCAGTGG - Intronic
1157941653 18:51935275-51935297 GAGTAGCATATTGTGTGCAGAGG - Intergenic
1158225166 18:55193362-55193384 TAGTAGGCTGTGATGTGTATGGG - Intergenic
1159461565 18:68727521-68727543 CAGTCTGCTATGATATGCAGTGG + Intronic
1161562410 19:4980985-4981007 GGCTAGGCTTTGAGGTGCAGTGG + Intronic
1166640953 19:44495074-44495096 GAGTGGACTCTGGTGTGCAGTGG - Intronic
1167263516 19:48472137-48472159 GGGTAGGCCATGAAGTGCAAAGG + Intronic
925280625 2:2682158-2682180 GAGGAGACAATGGTGTGCAGAGG + Intergenic
928461145 2:31473845-31473867 GAGTTGGATATCATGAGCAGAGG - Intergenic
934493458 2:94778229-94778251 GAGAAGGATATGATATTCAGGGG - Intergenic
937437208 2:121890324-121890346 CAGCTGGCTATGATGTGAAGCGG + Intergenic
938875087 2:135523912-135523934 GAGAAGGCTGTGAAGTACAGTGG + Intronic
940129719 2:150367470-150367492 TAGAAGTCTATGATGTGCTGGGG + Intergenic
944794334 2:203167227-203167249 GAGTAGGCTTTGATTTCAAGTGG + Exonic
946946769 2:224829665-224829687 GAGTAGAGTATGATGACCAGAGG + Intronic
947709118 2:232300629-232300651 GAGCAGTCTATGATGTGGAAAGG - Intronic
949023229 2:241752913-241752935 GCGTGGGGGATGATGTGCAGAGG - Intronic
1170683137 20:18544558-18544580 CAGGAGGCTAGGTTGTGCAGTGG + Intronic
1172340143 20:34151044-34151066 TGGTAGACTATGATGGGCAGAGG + Intergenic
1174345775 20:49928733-49928755 CAGTAAGCCATGATGGGCAGAGG + Intergenic
1174577982 20:51550647-51550669 GACTAAGCTATGGTGTTCAGTGG - Intronic
1175176166 20:57113768-57113790 GTTTAGGCCATGATGGGCAGGGG - Intergenic
1179161767 21:38905256-38905278 GAGACGGCTCTGATGAGCAGAGG + Intergenic
1180703625 22:17795381-17795403 GAATAGGCCATGCTGTGGAGCGG + Intronic
1181867575 22:25871142-25871164 GAGAAGGCTATGAAGCTCAGGGG + Intronic
1183797689 22:40133635-40133657 GAGAAGGCTATTATATGCAGAGG + Intronic
1184927583 22:47654101-47654123 CAGGAGGCTATGTTGTGAAGGGG + Intergenic
949836057 3:8271276-8271298 CAGTAGGCTATGAGGAGAAGTGG + Intergenic
951724271 3:25738981-25739003 GAGTAGGTTAGGTTGGGCAGGGG + Intronic
953628738 3:44593098-44593120 AAGTAGGCTATGATGTGACTAGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957909043 3:86598148-86598170 GAGTGGACTATGGTGAGCAGTGG + Intergenic
959781009 3:110233342-110233364 GAGCAGGCCATGCTGTGTAGTGG - Intergenic
965438628 3:168684771-168684793 CAGTAGCCTATCATGTGAAGAGG + Intergenic
965649127 3:170915156-170915178 TAGTAGTCTATGTTATGCAGTGG - Intergenic
970578995 4:17456605-17456627 GAGGAGGCTTTGTTGTCCAGTGG - Intergenic
978757806 4:112323137-112323159 GGGTAGGCTCTGAGGAGCAGGGG - Intronic
978835426 4:113143806-113143828 AAGTAGGCTATGATGTTTAATGG - Intronic
979545492 4:121935316-121935338 GAGTAGGGTATGATGTGTAGGGG + Intronic
980748639 4:137058179-137058201 GAGTAGGCGATGGTATGAAGTGG - Intergenic
983059276 4:163137478-163137500 GCCAAGGCTATGGTGTGCAGTGG + Intronic
985673728 5:1219603-1219625 CAGAAGGCGATGATGAGCAGGGG - Exonic
987061967 5:14251609-14251631 GAGGAGCCTATGCTGTCCAGAGG - Intronic
988779521 5:34507382-34507404 CACTAGGCTGTGATTTGCAGAGG - Intergenic
990413394 5:55563215-55563237 GGCTAAGCTATGATGTTCAGTGG + Intergenic
993917095 5:93756468-93756490 GAGGTGGCTGTGGTGTGCAGGGG - Intronic
993947040 5:94127699-94127721 AAGTTTGCTATGATGTGCATAGG - Intergenic
995887857 5:116916490-116916512 GAGGAGGCAGTGGTGTGCAGTGG + Intergenic
997447513 5:133952229-133952251 GAGGAGGCCATGCTTTGCAGTGG - Intergenic
998113883 5:139522070-139522092 GAGTAGGCAATGTAGTGCAGTGG + Intergenic
999628536 5:153545470-153545492 TAGAAGGTTATGATTTGCAGTGG - Intronic
1000181330 5:158814301-158814323 GCCCAGGCTATGAAGTGCAGTGG - Intronic
1001197019 5:169682459-169682481 GTTTAGGCAATGATTTGCAGAGG + Intronic
1001931413 5:175675750-175675772 GAGAAGGGTATGCTGAGCAGAGG - Intronic
1005411176 6:25548569-25548591 GAACAGGCTCTGGTGTGCAGAGG + Intronic
1010060330 6:71615284-71615306 GGGTAAGCACTGATGTGCAGTGG - Intergenic
1012182093 6:96166816-96166838 GAGTATGGGAGGATGTGCAGGGG - Intronic
1014233126 6:118926265-118926287 GGCTAAGCTATGATGTTCAGTGG - Intronic
1016451832 6:144190832-144190854 GAATAGGCCAGGACGTGCAGTGG - Intergenic
1016499181 6:144699777-144699799 GAATAGGCTATAATATTCAGAGG - Intronic
1021094178 7:16516587-16516609 GAGCAGTCTATTATTTGCAGTGG - Intronic
1022972563 7:35530947-35530969 GGGTAGGGTGTGATGTGGAGAGG - Intergenic
1032812180 7:135431223-135431245 GCCCAGGCTATGAAGTGCAGTGG - Intronic
1033052864 7:138022177-138022199 GAGCAGGCAATGATGTGGTGGGG + Intronic
1036583866 8:10104765-10104787 GTTCAGGCTATGATGTGAAGGGG - Intronic
1039376616 8:37040972-37040994 GGGCAGCATATGATGTGCAGAGG + Intergenic
1043216089 8:77590851-77590873 CAGGAGGATATGAGGTGCAGGGG + Intergenic
1048791994 8:138112743-138112765 GAGTAGGGAATGATGTTCAGGGG + Intergenic
1049945054 9:586355-586377 GGATAGGCTGTGATCTGCAGAGG + Intronic
1050332046 9:4555524-4555546 GAGAAGGCTCTGATGAGCAAGGG - Intronic
1050719069 9:8564237-8564259 GGCTAAGCTATGATGTTCAGTGG + Intronic
1053663610 9:40301808-40301830 GAGAAGGATATGATATTCAGGGG + Intronic
1053914125 9:42932350-42932372 GAGAAGGATATGATATTCAGGGG + Intergenic
1054375734 9:64448041-64448063 GAGAAGGATATGATATTCAGGGG + Intergenic
1054521005 9:66074477-66074499 GAGAAGGATATGATATTCAGGGG - Intergenic
1056444125 9:86648385-86648407 AAGGAGGCTAAGATGTGCTGAGG - Intergenic
1060159301 9:121345824-121345846 GAGGAGGCAATGAGGAGCAGAGG + Intronic
1062117860 9:134818766-134818788 GAGTAGGCTGTGAGGGGCAGAGG + Intronic
1186214519 X:7284446-7284468 CAGTGGGATGTGATGTGCAGGGG + Intronic
1187132066 X:16512597-16512619 GACTAGGCCATTATGTGCTGGGG - Intergenic
1189605027 X:42668040-42668062 GAGTATCCTATGGTGTGCTGAGG + Intergenic
1192429316 X:71101760-71101782 TAATAGGCTATGAGGTGCTGTGG - Intronic
1192548028 X:72029474-72029496 GAATAGGCCATGATGTCCTGAGG + Intergenic
1197311069 X:124906095-124906117 GACTAAGTTATGATGTTCAGTGG - Intronic
1198019554 X:132644749-132644771 GAGGAGGAACTGATGTGCAGTGG - Intronic
1199079326 X:143558791-143558813 GAGTAGGCTTTGATTGGCAAGGG - Intergenic
1201964895 Y:19721345-19721367 GAGTAGGATACGATGAGGAGAGG + Intronic