ID: 1066145035

View in Genome Browser
Species Human (GRCh38)
Location 10:32548641-32548663
Sequence ACATCGGATGTTCTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066145035 Original CRISPR ACATCGGATGTTCTCACTGT AGG (reversed) Intronic
900709521 1:4104801-4104823 ACACCGCATGTTCTCACTCATGG + Intergenic
902837170 1:19054593-19054615 ACAAAGGCTGTTCCCACTGTGGG - Intergenic
906590110 1:47016932-47016954 ACATCACATGTTCTCACTTGTGG - Intergenic
912646692 1:111399651-111399673 ACACCGCATGTTCTCACTCATGG + Intergenic
915694825 1:157729258-157729280 ACGCCGCATGTTCTCACTCTAGG + Intergenic
918731274 1:188000609-188000631 TCAAAGGATGTTCTCACTGAAGG + Intergenic
918946451 1:191072009-191072031 ACACCACATATTCTCACTGTGGG + Intergenic
919164650 1:193876766-193876788 ACACTGCATGTTCTCACTCTAGG + Intergenic
920866155 1:209755804-209755826 AGATGAGATGTTCTCAGTGTAGG - Intergenic
923229350 1:231969828-231969850 ACATGGTATGTTCTCACTCATGG - Intronic
923276900 1:232404342-232404364 ACATTTCATGTTTTCACTGTTGG + Intronic
1064367536 10:14721073-14721095 ACACCGCATGTTCTCACTCATGG - Intronic
1064879358 10:20032946-20032968 ACACTGCATGTTCTCACTCTTGG + Intronic
1066033622 10:31456169-31456191 ACACCGCATGTTCTCACTCATGG + Intronic
1066145035 10:32548641-32548663 ACATCGGATGTTCTCACTGTAGG - Intronic
1068004287 10:51374322-51374344 ACACCGCATGTTCTCACTCATGG - Intronic
1069459973 10:68585523-68585545 ACATCAGAGGTTCTTACTCTGGG + Intronic
1073607336 10:104909643-104909665 CCATCTGATGTTCTCAATCTGGG - Intronic
1075643024 10:124078857-124078879 GCATAAGATGTTCTCCCTGTGGG + Intronic
1076718675 10:132382578-132382600 GCATCGCTTGTTCTCACTCTTGG + Intergenic
1079365999 11:19810695-19810717 TCACAGGATGTTCTCACTGTTGG - Intronic
1081555612 11:44157870-44157892 ACACAGGCAGTTCTCACTGTGGG - Intronic
1082588097 11:54968465-54968487 ACACCGCATGTTCTCACTCATGG - Intergenic
1082608370 11:55270464-55270486 ACATCGGAAGATATGACTGTTGG - Exonic
1083077222 11:60053618-60053640 ACATCACATGTTCTCACTTGTGG + Intergenic
1085009083 11:73124172-73124194 ACACCGCATGTTCTCACTCATGG + Intronic
1086696289 11:89850322-89850344 ACATCGGAAGATATGACTGTTGG - Intergenic
1086709867 11:89994167-89994189 ACATCGGAAGATATGACTGTTGG + Intergenic
1088696671 11:112371897-112371919 ACACCGCATGTTCTCACTCATGG - Intergenic
1090111747 11:123918274-123918296 ACATTGATTGTTCTCCCTGTTGG + Intergenic
1091318083 11:134629982-134630004 ACACCGCATGTTCTCACTCATGG + Intergenic
1094382111 12:29854369-29854391 ACACCGCATGTTCTCACTCATGG + Intergenic
1094484096 12:30910266-30910288 AAGTTGGAGGTTCTCACTGTGGG + Intergenic
1100425914 12:94486192-94486214 ACACCGCATGTTCTCACTTATGG + Intergenic
1102204321 12:111079795-111079817 ACATGGGATGTTCCAAGTGTGGG + Intronic
1103926367 12:124425641-124425663 ACATCGCAGATTCTCACTGTGGG + Intronic
1106573106 13:30947968-30947990 ACACCGCATGTTCTCACTCATGG - Intronic
1106578047 13:30994092-30994114 ACACCGCATGTTCTCACTCGTGG + Intergenic
1110071801 13:71187040-71187062 ACACTGCATGTTCTCACTATAGG + Intergenic
1110414913 13:75241381-75241403 ACACCGCATGTTCTCACTCATGG - Intergenic
1110998203 13:82140515-82140537 ACACCGCATGTTCTCACTCATGG + Intergenic
1111733521 13:92107415-92107437 ACATCGACTTTTCTCAGTGTTGG + Intronic
1113215533 13:108036482-108036504 ACATCGGCTGTTCTTTCTGCAGG + Intergenic
1117399369 14:55344795-55344817 ACACCGCATGTTCTCACTGTGGG - Intronic
1120408135 14:84115258-84115280 ACACCGCATGTTCTCCCTATAGG - Intergenic
1124922616 15:34041069-34041091 AAATCGGAGTTTCTCAATGTTGG + Intronic
1126302574 15:47214870-47214892 ACATCAGAACTTCTTACTGTTGG + Intronic
1130399881 15:83541017-83541039 ACATCAGATGTTCTCATTTGTGG - Intronic
1131500296 15:92956914-92956936 ACATCAGACCTTTTCACTGTTGG + Intronic
1133315438 16:4880670-4880692 ACCTAGGGTGTGCTCACTGTGGG + Exonic
1133783706 16:8958926-8958948 ACATCGGATATGGTTACTGTGGG + Intronic
1138807225 16:60104713-60104735 ACATAGGACATTCTCATTGTTGG + Intergenic
1140292819 16:73678848-73678870 ACACCCGATGTTCTCGTTGTTGG + Intergenic
1150855560 17:68749042-68749064 GCACCGCATGTTCTCACAGTGGG - Intergenic
1153177917 18:2399888-2399910 ACACCGCATGTTCTCACTCATGG + Intergenic
1154013487 18:10595569-10595591 ATATAGGATGTGCCCACTGTGGG - Intergenic
1154152711 18:11919164-11919186 ATATAGGATGTGCCCACTGTGGG - Intergenic
1154327508 18:13402065-13402087 GCATCAGATGTTCTCATTTTAGG - Intronic
1156515082 18:37672384-37672406 AAACCAGATGTTCTAACTGTCGG - Intergenic
1156663069 18:39371304-39371326 ACACCGCATGTTCTCACTCTAGG + Intergenic
1157025813 18:43841381-43841403 ACACCGCATGTTCTCACTTATGG + Intergenic
1157744744 18:50125284-50125306 ACACCGCATGTTCTCACTCATGG + Intronic
1158272151 18:55728198-55728220 ACTACGGCTGTTCTAACTGTAGG + Intergenic
1163146412 19:15382018-15382040 GCACTGGATGTTGTCACTGTTGG + Intronic
1163206249 19:15805259-15805281 ATATGGGATGTTTTGACTGTGGG + Intergenic
1166180662 19:41105931-41105953 ACACCGCATGTTCTCACTCATGG + Intergenic
925861765 2:8184465-8184487 ACACCGCATGTTCTCACTCATGG + Intergenic
928775025 2:34750348-34750370 ACACCGCATGTTCTCACTCATGG + Intergenic
931292709 2:60889693-60889715 ACACCGCATGTTCTCACTCATGG - Intronic
931482262 2:62653391-62653413 ACACCGCATGTTCTCACTCATGG + Intergenic
932520808 2:72409949-72409971 GCATCCCATGTTCTCATTGTGGG - Intronic
934897450 2:98131184-98131206 ATATCGCATGTTCTCACTCATGG - Intronic
938733634 2:134166013-134166035 ACATAGCAGGTTCTCACTATAGG + Intronic
939045055 2:137240049-137240071 CCATCCGATGTTTTCACTTTGGG + Intronic
940955688 2:159724910-159724932 ACATGGCATGTTCTCACTCATGG - Intronic
942875151 2:180786411-180786433 ACACCGCATGTTCTCACTCATGG + Intergenic
946230729 2:218289802-218289824 ACATGGCATGTTCTCAGTATGGG + Intronic
947057938 2:226128501-226128523 ACATTGGAAGCACTCACTGTGGG - Intergenic
948314662 2:237018167-237018189 GCCACGGATGTTCCCACTGTTGG - Intergenic
1168844532 20:934768-934790 ACTGAGGATGTTGTCACTGTTGG + Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1173786620 20:45798244-45798266 ACACCGCATGTTCTCACTCATGG + Intronic
1175672772 20:60920324-60920346 ACCTCCAATGGTCTCACTGTGGG + Intergenic
1179696072 21:43119429-43119451 ACACCGCATGTTCTCACTCATGG - Intergenic
951749814 3:26022039-26022061 ACATTGTGTGTTCTCACTATGGG - Intergenic
953271149 3:41446639-41446661 ACACCGCAAGTTCTCACTGATGG + Intronic
955816105 3:62845071-62845093 ACACAGGATGCTATCACTGTGGG + Intronic
959540410 3:107531125-107531147 AGATTGGATGTTCTGAATGTGGG + Intronic
961716693 3:128862501-128862523 ACACTGCATGTTCTCACTATAGG + Intergenic
961869048 3:129975021-129975043 ACATCGGAGGCTCTCGCTGCTGG + Intronic
962340930 3:134582408-134582430 ACATTACATGTTCTCACTCTTGG - Intergenic
964644915 3:158948696-158948718 ACATCCTATGTTCTTGCTGTAGG + Intergenic
965351672 3:167619504-167619526 ACATAGGAAATTCTTACTGTGGG + Intronic
966441391 3:179948980-179949002 TCATGGGATCTGCTCACTGTTGG - Intronic
969308941 4:6340905-6340927 ACATGGGCTGTTCCCACTGTTGG + Intronic
969900014 4:10340473-10340495 ACACCGCATGTTCTCATAGTGGG + Intergenic
970645923 4:18120274-18120296 ACACCGCATGTTCTCACCATAGG + Intergenic
972915925 4:43879856-43879878 ACACCGAATGTTCTCACTCATGG + Intergenic
973048369 4:45565519-45565541 ACACCGCATGTTCTCACTAATGG - Intergenic
973987447 4:56368631-56368653 ACACCGCATGTTCTCACTCATGG + Intronic
974425531 4:61738153-61738175 ACATCGTATGTTCTCACAAGTGG - Intronic
975306284 4:72852644-72852666 ACACCGCATGTTCTCACTCACGG + Intergenic
976529976 4:86140445-86140467 ACACCGCATGTTCTCACTCATGG + Intronic
976532632 4:86172486-86172508 ACACCGCATGTTCTCACTCATGG + Intronic
979772493 4:124545912-124545934 ATTTAGGATGTTCTCACTTTGGG - Intergenic
980139819 4:128901433-128901455 ACACCGCATGTTCTCACTCTTGG + Intronic
983203026 4:164882821-164882843 ACACCGCATGTTCTCACAGGTGG - Intronic
986296266 5:6441209-6441231 ATACCGCATGTTCTCACTTTTGG - Intergenic
986549037 5:8932406-8932428 ACACCGCATGTTCTCACTCATGG + Intergenic
988224097 5:28389785-28389807 ACACCGCATGTTCTCACTCATGG - Intergenic
989520177 5:42392178-42392200 ACACCGCATGTTCTCACTCATGG - Intergenic
993879578 5:93346933-93346955 ACACTGCATGTTCTCACTCTAGG - Intergenic
996255107 5:121391200-121391222 AAATCTGATATTCTCACTCTTGG - Intergenic
999262929 5:150248564-150248586 ACAGCGCATGTTCTCACTCATGG - Intronic
1001358621 5:171058390-171058412 ACACCGCATGTTCTCACTCATGG - Intronic
1003225210 6:4198745-4198767 ACACCGCATGTTCTCACTCATGG - Intergenic
1003242628 6:4358080-4358102 ACACCGCATGTTCTCACTCATGG + Intergenic
1006882514 6:37352703-37352725 CCATTGGATGTACTCACTGCAGG + Intergenic
1008493950 6:52114047-52114069 ACACCGCATGTTCTCACTCATGG + Intergenic
1010312776 6:74407053-74407075 ACACCGCATGTTCTCACTCATGG + Intergenic
1011967806 6:93181249-93181271 ACACCGCATGTTCTCACTCATGG - Intergenic
1012868115 6:104642117-104642139 ACACCGCATGTTCTCACTCATGG - Intergenic
1016176670 6:141085001-141085023 ACATTGCATGTTCTCACTCGTGG + Intergenic
1018552717 6:165016664-165016686 ACACCGCATGTTCTCACAGTGGG - Intergenic
1019290978 7:250029-250051 GGATCGGAGGCTCTCACTGTAGG + Intronic
1021414297 7:20364624-20364646 ACATCTGGTTTTCTCACTGGTGG - Intronic
1022529514 7:31058106-31058128 ACATCAGAGCTTCCCACTGTGGG + Intronic
1024591741 7:50892300-50892322 ACACCGCATGTTCTCACTTATGG + Intergenic
1026127174 7:67589064-67589086 AGATGGGAGGTTCTCACTGGAGG + Intergenic
1026381773 7:69807216-69807238 ACATTGGATTGTGTCACTGTGGG + Intronic
1030178924 7:106684612-106684634 ACACCGCATGTTCTCACTCATGG - Intergenic
1030897898 7:115084525-115084547 ACATCTCATGTTCTCACTCATGG + Intergenic
1031186506 7:118487694-118487716 ACATCGGATGTTCTCATAAGTGG + Intergenic
1036886748 8:12562584-12562606 ACATTGCATGTTCTCACTCGTGG - Intergenic
1037549825 8:19959353-19959375 GAATGGGATGTTCTCACTCTCGG - Exonic
1037868298 8:22466066-22466088 ACACCACATGTTCTCACTCTTGG - Intronic
1040042902 8:42934621-42934643 ACACCGCATGTTCTCACTCATGG - Intronic
1041186021 8:55301224-55301246 ACACCGCATGTTCTCACTCCTGG - Intronic
1041769720 8:61459574-61459596 ACATCTTATGTTCTCACCGATGG - Intronic
1043364458 8:79516299-79516321 ACACCGCATGTTCTCACTCATGG - Intergenic
1050355106 9:4775282-4775304 ACACCGCATGTTCTCACTCATGG + Intergenic
1050809894 9:9731721-9731743 ACACCGCATGTTCTCACTCATGG + Intronic
1052020535 9:23520596-23520618 ACACCGCATGTTCTCACTCATGG + Intergenic
1052899748 9:33782181-33782203 ACATGGGTTTGTCTCACTGTTGG - Intronic
1053297735 9:36926991-36927013 ACTTCGGCTGTTCTCAGTCTTGG - Intronic
1054702318 9:68425316-68425338 AGATGGGATGCTTTCACTGTGGG - Intronic
1055176247 9:73321091-73321113 ACACCGTATGTTCTCACTCATGG - Intergenic
1055767369 9:79678850-79678872 ACACCGCATGTTCTCACTCATGG - Intronic
1055808368 9:80122085-80122107 ACACCGCATTTTCTCACTGTTGG + Intergenic
1059259174 9:112959436-112959458 ACATCCGGTGTTCGAACTGTGGG + Intergenic
1059984666 9:119810303-119810325 ACAGAGGAAGTACTCACTGTAGG + Intergenic
1060430358 9:123545920-123545942 AAATCAGATGTTCTCACTTTAGG - Intronic
1187192718 X:17051089-17051111 ACATCGCATGTTCTCATTTGTGG - Intronic
1188712810 X:33422381-33422403 ACACCGCATGTTCTCACTCATGG - Intergenic
1188733644 X:33684327-33684349 ACACCGCATGTTCTCACTCATGG + Intergenic
1189366733 X:40394623-40394645 ACATGGGATCTTCTCATTGGTGG + Intergenic
1192142363 X:68656770-68656792 ACACCGCATGTTCTCACTCATGG + Intronic
1192713013 X:73611248-73611270 ACACCGCATGTTCTCACTCATGG - Intronic
1192970642 X:76225319-76225341 ACACCGCATGTTCTCACTAATGG - Intergenic
1193559614 X:83001640-83001662 ACATTGCATGTTCTCACTCATGG + Intergenic
1196808643 X:119610847-119610869 AAATAGGATGTTCTCATTTTGGG - Intergenic
1199316390 X:146383418-146383440 ACAGCTCATGTTCTCACTTTAGG + Intergenic
1200529166 Y:4313633-4313655 ACACCGCATGTTCTCACTCATGG + Intergenic