ID: 1066160319

View in Genome Browser
Species Human (GRCh38)
Location 10:32721243-32721265
Sequence GACAAATTTTGGCCTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066160319_1066160322 12 Left 1066160319 10:32721243-32721265 CCAATAACAGGCCAAAATTTGTC 0: 1
1: 0
2: 0
3: 54
4: 326
Right 1066160322 10:32721278-32721300 TGTAGATTTCAGCTGATTTTGGG No data
1066160319_1066160321 11 Left 1066160319 10:32721243-32721265 CCAATAACAGGCCAAAATTTGTC 0: 1
1: 0
2: 0
3: 54
4: 326
Right 1066160321 10:32721277-32721299 GTGTAGATTTCAGCTGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066160319 Original CRISPR GACAAATTTTGGCCTGTTAT TGG (reversed) Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
908652450 1:66350526-66350548 GACTAATTTAGGCCTGTTGAGGG - Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910352548 1:86315281-86315303 AACAAATTTTAGCCTTTTATAGG - Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910831095 1:91463388-91463410 GATAGCTCTTGGCCTGTTATTGG - Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911981897 1:104579226-104579248 GAAAACTCTTGGCCTGTTATTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
912943810 1:114068168-114068190 GACAGCTTTTAGCCTGTTACTGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918509389 1:185293771-185293793 GACTAGTTTTGGCCTGTGACAGG + Intergenic
918857131 1:189771008-189771030 AACAAATTTTGGGGTCTTATTGG - Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919241775 1:194924240-194924262 GACAGCTATTGGCCTGTTAATGG + Intergenic
919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG + Intergenic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924491846 1:244545616-244545638 GACAATTCTTGGCCTACTATTGG + Intronic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1065973816 10:30825374-30825396 GACAAAGTTTGGGCTGTGTTGGG - Intronic
1066156047 10:32679202-32679224 GACAATTATTGGCCTTTTATTGG - Intronic
1066160319 10:32721243-32721265 GACAAATTTTGGCCTGTTATTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069008192 10:63341485-63341507 CACAAGTTTTTGCCTGTCATAGG - Intronic
1069035222 10:63639310-63639332 GACAAATTTTGTCTAGTTTTAGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1070216862 10:74393858-74393880 GACAAATGCTGGCCTGATATAGG - Intronic
1070481261 10:76884865-76884887 TACAAATTTTATTCTGTTATTGG - Exonic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1072209256 10:93231642-93231664 GACAGATCTTGGCTTGTTACTGG - Intergenic
1073816755 10:107215437-107215459 AACAACTTTTAGCCAGTTATGGG + Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1078704384 11:13725807-13725829 GACAATTTTTGACCTTTAATTGG + Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG + Intergenic
1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1082745900 11:56962619-56962641 CACAGATTGGGGCCTGTTATTGG - Intergenic
1082760189 11:57119879-57119901 GAAAAATTGAGGCCTGTTAAAGG - Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086278614 11:85160462-85160484 AACAGCTCTTGGCCTGTTATTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090075299 11:123577048-123577070 GACAATTTTTGGCATATAATAGG + Intronic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1091193598 11:133714263-133714285 GACAAATTCTGCCCTGCTAAGGG - Intergenic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092332021 12:7593688-7593710 AACAAATTGTGGCATGTTAGTGG + Intergenic
1092403825 12:8201600-8201622 GACAAATTTTGACTTTTTAAAGG - Intergenic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1095775473 12:46004890-46004912 GACAAATTGTCTCCAGTTATAGG - Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097457528 12:59818323-59818345 AAGAAATTTTGACTTGTTATAGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098718610 12:73865539-73865561 AAAAAATTTTGTCCTGTTAGGGG - Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101687980 12:107044506-107044528 GACAGACTTTCACCTGTTATTGG - Intronic
1103854749 12:123958860-123958882 GAAAAATGTAGGCCTGTCATAGG - Intronic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1107165472 13:37277746-37277768 GACAATTATTGGCTTCTTATTGG + Intergenic
1107362126 13:39630550-39630572 AACAAATAGTGGCCTGGTATGGG - Intergenic
1109039885 13:57319215-57319237 GATAAATATTGGCCTGTTTGTGG - Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110615494 13:77537160-77537182 TAAAAATTCTGGCCTGTTGTTGG - Intronic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110928917 13:81191556-81191578 GACAAATTTAGGTCTGGAATAGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111432252 13:88159623-88159645 GACAGATCTTGGCCTGCTACTGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115872099 14:37816285-37816307 GATAAATTTTCTGCTGTTATTGG - Intronic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118095476 14:62532509-62532531 GAAAAATATAGGCCTGTTCTGGG - Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1125340695 15:38672596-38672618 GACAATTTTTGGTATGTTTTAGG + Intergenic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1128823263 15:70682373-70682395 GACAAAATATTGACTGTTATGGG - Intronic
1129934195 15:79435778-79435800 GACAGATTTTGGCTTATTGTAGG + Intronic
1129994281 15:79991178-79991200 GACACATGATGCCCTGTTATGGG - Intergenic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1136376523 16:29868867-29868889 CACAAAGTTTGGCCATTTATTGG + Intergenic
1139817498 16:69687107-69687129 GAGACATTTTGGACTGTTTTTGG + Intronic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1144855523 17:18265274-18265296 GACAGATTTTTGGCTGTTAAAGG + Exonic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1150034867 17:61783785-61783807 GACTAATTTTGGCCAGGCATGGG + Intronic
1150208013 17:63423737-63423759 GACAAGTCCTGGCCTGTTTTAGG - Exonic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156606372 18:38671772-38671794 GACATTTCTTGGCCTGTGATTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1158011297 18:52730966-52730988 GACAAATTTTATTCTTTTATTGG - Intronic
1159105277 18:63997181-63997203 AACAATTATTGTCCTGTTATTGG + Intronic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159833600 18:73308622-73308644 GACAAATTCTGTACTGTTGTGGG + Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1164097085 19:22021336-22021358 GACAACTCTTGGCCTATTACTGG - Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1166370625 19:42298616-42298638 GACAACTTTTGGCCTATTCAAGG + Intronic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927085354 2:19669773-19669795 GCCACATGTTGGCCTGTTATGGG + Intergenic
928728317 2:34201816-34201838 GACATATTTTTCCCTGTTTTAGG - Intergenic
929084842 2:38158122-38158144 GACAACTCTCAGCCTGTTATTGG - Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG + Intergenic
932148037 2:69341585-69341607 GGCAAATATTGGTCTTTTATTGG + Intronic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
941117617 2:161489612-161489634 GAGCAATTTTGGCCTGACATGGG - Intronic
942141677 2:172983759-172983781 ATCAAATTTTGTCCTATTATTGG + Intronic
942216399 2:173723809-173723831 GACCAACTTTGTCCTTTTATTGG - Intergenic
943048540 2:182888054-182888076 GGAAAATTTTAGCCTGTTGTTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945725844 2:213471486-213471508 GACAGATGTTGGTCTGTTACTGG - Intronic
946553384 2:220827616-220827638 GTCCAATTTGGGGCTGTTATTGG + Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1171330071 20:24329662-24329684 AACAGCTTTTGGCCTGTCATTGG - Intergenic
1172474711 20:35227521-35227543 GACAAATTTGGGCTCGATATAGG + Intronic
1172933682 20:38603327-38603349 GAGTAATTTTTGCCTGTGATGGG - Intronic
1173155392 20:40604326-40604348 CACCAATTTTGGCATATTATAGG - Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177169889 21:17643370-17643392 GTCTAATTTTTGCCTGTGATTGG - Intergenic
1177436896 21:21066761-21066783 AACAAATTTTAGCTTGCTATAGG - Intronic
1177505560 21:22014173-22014195 GACAGCTTTTGGCCTGCTACTGG - Intergenic
1177781014 21:25622415-25622437 AACAGCTTTTGGCCTGCTATTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177954721 21:27583604-27583626 GGCAAGTGTTGGGCTGTTATGGG - Intergenic
1177991071 21:28037129-28037151 GACAGCTTGTGGCCTGTTACTGG - Intergenic
1178668911 21:34573254-34573276 GACACATTTTGGCATGGTAATGG + Intronic
1178716909 21:34973314-34973336 GACAAATTTTTGTCTGTGAATGG + Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181366699 22:22381854-22381876 GACAAATTTTGGCATTTTTCTGG + Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
1184635665 22:45827623-45827645 CATATATTTTGGCCTGTTATCGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
949970580 3:9399492-9399514 CAAAAATTCTGGCCTGTTATGGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
952029283 3:29121200-29121222 GCCAAATTTTTGCCTGGTAAGGG + Intergenic
954217048 3:49130498-49130520 CACAAATTCTGGCCTGTGATAGG - Intronic
955418753 3:58716559-58716581 GACCACTTTTGGCCTGCTACTGG - Intergenic
956504589 3:69923795-69923817 CACATATATTGGCCTGGTATAGG + Intronic
957274688 3:78075688-78075710 GAGAAATGTTGGCTTTTTATAGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959746013 3:109777265-109777287 GACAGCTTTTGGACTGTTACTGG - Intergenic
960223222 3:115141780-115141802 GTCAAAATTTGGGGTGTTATTGG - Intronic
962169706 3:133088076-133088098 GAAACATTTTAGCCTGTTATAGG + Intronic
963030972 3:140975607-140975629 GAGAAATTTTGGCCAGTTGTGGG - Intronic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965952351 3:174325646-174325668 GAGAAATTTTGGACTATTTTGGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968412584 4:402846-402868 GACTAATAAAGGCCTGTTATTGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
970146622 4:13042775-13042797 TCCAAATTTTGGCTTGTCATTGG - Intergenic
971979294 4:33732865-33732887 GACAGCTCTTGGCCTGCTATTGG - Intergenic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974769842 4:66397856-66397878 GAATAGTTTTGGCTTGTTATTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
976774582 4:88693845-88693867 GACTAATTTTGGCCTATAATAGG + Intronic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978341589 4:107725541-107725563 GACAGCTTGTGGCCTGTTACTGG - Intergenic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979926087 4:126566501-126566523 GACAAAATTTGCCTTCTTATTGG - Intergenic
980387946 4:132111173-132111195 GACAACACTTGGCCTGTTACTGG - Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982161129 4:152570592-152570614 TACAAATTTTGGCAAGTTGTAGG + Intergenic
982507926 4:156242980-156243002 GACAAATCTTGGATAGTTATTGG - Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
984441724 4:179779381-179779403 GACAGATTTTGGTCTGCTCTTGG + Intergenic
985806930 5:2052742-2052764 GACAGATATTGCCCTGTTCTAGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988160824 5:27516862-27516884 GACAGATCTAGGCCTGTTACTGG - Intergenic
988165510 5:27584198-27584220 GACAAATTAAGGCTTGTTTTGGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988280983 5:29147158-29147180 GGCAAATGATGGCCTTTTATTGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
992239091 5:74747005-74747027 GAGAGATTGTGGCCTGTGATGGG - Intronic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993390804 5:87318252-87318274 AGCAAAATTTGGCCTGTTAGAGG + Intronic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995233114 5:109793238-109793260 GACCCATTTTGGCCTGATCTAGG - Intronic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995945837 5:117644875-117644897 GCGAAATTTTGTCCAGTTATTGG - Intergenic
996111985 5:119576873-119576895 CAAATATTTTGGCCTGCTATGGG - Intronic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996655611 5:125931214-125931236 GAAAAATTTTGGCCTTTCGTTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
999448070 5:151657276-151657298 GACAGACTTTGGCCTGTTTCAGG + Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000971374 5:167718325-167718347 GACAAATTGGGTCCTGTTTTGGG + Intronic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1004025116 6:11810682-11810704 GACAAATATTTGCATGTGATCGG - Intergenic
1005185170 6:23157082-23157104 GACAGCTGTTGGGCTGTTATTGG + Intergenic
1005669391 6:28089981-28090003 CACAGATTTTGGCCTCATATAGG - Intergenic
1007968985 6:46031603-46031625 GACAAATTTGGGCCTTATAATGG + Intronic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1008311622 6:49982784-49982806 GACAAGTTTCAGCCAGTTATAGG + Intergenic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1012675860 6:102112048-102112070 TACAAATTTTCTCCTGTGATTGG - Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013768763 6:113603455-113603477 GAGAAATGGTGGCCAGTTATAGG + Intergenic
1014036692 6:116774966-116774988 GACACACTGGGGCCTGTTATGGG - Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1017872273 6:158496834-158496856 GACAAATGCTGGCCTTTTTTGGG + Intronic
1018122927 6:160655213-160655235 GACAGCTATTGGTCTGTTATTGG - Intronic
1018535030 6:164810484-164810506 GACCACTCTTGGCCTGTTACTGG - Intergenic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1019765607 7:2847786-2847808 GACACATTATGGCATTTTATGGG + Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028399435 7:90408623-90408645 GCTAAATTTTGGCCTGATACTGG - Intronic
1028441806 7:90871410-90871432 GAATAATTTTGGCATCTTATTGG - Intronic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031474446 7:122205344-122205366 GACAGACCTTGGCCTGTTACTGG - Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1033554998 7:142481551-142481573 GAAAAATTGTGTCCTGTTCTAGG + Intergenic
1037073259 8:14679345-14679367 GACAACTCTATGCCTGTTATTGG + Intronic
1037575239 8:20196868-20196890 AACATATATTGGCTTGTTATAGG - Intergenic
1038555781 8:28513852-28513874 GTCAAATTTTGGCCTTTGACTGG + Intronic
1041574058 8:59372702-59372724 TCCAAATTTTGGCCTCTTATGGG + Intergenic
1042542538 8:69921700-69921722 CACCAATTTTGTCCTGTTAGTGG + Intergenic
1044273456 8:90273516-90273538 GCCAAATTTCAGCCGGTTATAGG + Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047184876 8:122623908-122623930 GACAAATGTTGGCCAATGATGGG + Intergenic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056131955 9:83595955-83595977 GATTAATTTTTGCCTGTTTTGGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1057396533 9:94685718-94685740 GACAAGTTTTCCCTTGTTATGGG + Intergenic
1057441642 9:95087909-95087931 CACAAATTCTGGCCTGTTTGGGG + Intergenic
1058761597 9:108138926-108138948 GAGAAATTTTGGTCTATTCTGGG + Intergenic
1059386728 9:113970548-113970570 GACAAACTATGGCCATTTATGGG - Intronic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1187756888 X:22538024-22538046 GACAAATTTGAGGGTGTTATTGG + Intergenic
1188073210 X:25743412-25743434 AACAAAACTTGGCCTGTTTTAGG + Intergenic
1188638656 X:32469497-32469519 GACAAATTTTGGGTTGATATAGG - Intronic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1189291174 X:39887141-39887163 GAGAAATTTAGGCTTGTCATTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1192019692 X:67374255-67374277 GACACATTTTTGACTTTTATAGG - Intergenic
1192267725 X:69551157-69551179 GACAAACTTTGGGTTGTTTTTGG - Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194482725 X:94446572-94446594 GACAGCATTTGGCCTGCTATTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197097469 X:122612844-122612866 GACAGGTTTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200916568 Y:8576338-8576360 AAGAAAAGTTGGCCTGTTATCGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202134541 Y:21648071-21648093 GAGAGATCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic