ID: 1066163677

View in Genome Browser
Species Human (GRCh38)
Location 10:32762024-32762046
Sequence AAATATCCACATATTGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066163670_1066163677 20 Left 1066163670 10:32761981-32762003 CCAGAAAGTGGTTGAGCGACTCC 0: 1
1: 0
2: 2
3: 5
4: 47
Right 1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG No data
1066163673_1066163677 -1 Left 1066163673 10:32762002-32762024 CCTACACATTGGGAAACTGAAAA No data
Right 1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066163677 Original CRISPR AAATATCCACATATTGGGTA GGG Intronic
No off target data available for this crispr