ID: 1066163677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:32762024-32762046 |
| Sequence | AAATATCCACATATTGGGTA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066163670_1066163677 | 20 | Left | 1066163670 | 10:32761981-32762003 | CCAGAAAGTGGTTGAGCGACTCC | 0: 1 1: 0 2: 2 3: 5 4: 47 |
||
| Right | 1066163677 | 10:32762024-32762046 | AAATATCCACATATTGGGTAGGG | No data | ||||
| 1066163673_1066163677 | -1 | Left | 1066163673 | 10:32762002-32762024 | CCTACACATTGGGAAACTGAAAA | No data | ||
| Right | 1066163677 | 10:32762024-32762046 | AAATATCCACATATTGGGTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066163677 | Original CRISPR | AAATATCCACATATTGGGTA GGG | Intronic | ||
| No off target data available for this crispr | |||||