ID: 1066167025

View in Genome Browser
Species Human (GRCh38)
Location 10:32799194-32799216
Sequence GTCAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066167025_1066167028 11 Left 1066167025 10:32799194-32799216 CCAGTAACAGGCCAAGAGCTGAC No data
Right 1066167028 10:32799228-32799250 GAATGATTATCTGCAGAAGACGG No data
1066167025_1066167029 15 Left 1066167025 10:32799194-32799216 CCAGTAACAGGCCAAGAGCTGAC No data
Right 1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG No data
1066167025_1066167030 16 Left 1066167025 10:32799194-32799216 CCAGTAACAGGCCAAGAGCTGAC No data
Right 1066167030 10:32799233-32799255 ATTATCTGCAGAAGACGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066167025 Original CRISPR GTCAGCTCTTGGCCTGTTAC TGG (reversed) Intronic
No off target data available for this crispr