ID: 1066167029

View in Genome Browser
Species Human (GRCh38)
Location 10:32799232-32799254
Sequence GATTATCTGCAGAAGACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066167024_1066167029 16 Left 1066167024 10:32799193-32799215 CCCAGTAACAGGCCAAGAGCTGA 0: 3
1: 187
2: 195
3: 154
4: 275
Right 1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG No data
1066167023_1066167029 22 Left 1066167023 10:32799187-32799209 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG No data
1066167027_1066167029 4 Left 1066167027 10:32799205-32799227 CCAAGAGCTGACTCTCAAAAGGA 0: 4
1: 191
2: 200
3: 179
4: 314
Right 1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG No data
1066167025_1066167029 15 Left 1066167025 10:32799194-32799216 CCAGTAACAGGCCAAGAGCTGAC No data
Right 1066167029 10:32799232-32799254 GATTATCTGCAGAAGACGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066167029 Original CRISPR GATTATCTGCAGAAGACGGC AGG Intronic
No off target data available for this crispr