ID: 1066167982

View in Genome Browser
Species Human (GRCh38)
Location 10:32808521-32808543
Sequence TCCAGACAGTGTACATGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066167982_1066167985 3 Left 1066167982 10:32808521-32808543 CCACATCATGTACACTGTCTGGA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1066167985 10:32808547-32808569 TCAAGGACCCACCTACCTGCTGG No data
1066167982_1066167988 11 Left 1066167982 10:32808521-32808543 CCACATCATGTACACTGTCTGGA 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1066167988 10:32808555-32808577 CCACCTACCTGCTGGCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066167982 Original CRISPR TCCAGACAGTGTACATGATG TGG (reversed) Intronic
902307896 1:15556706-15556728 TCCTGACAGCTGACATGATGTGG + Intronic
903702145 1:25257357-25257379 TCCAGACAGTGTATTTCATTTGG + Intronic
917043112 1:170828311-170828333 TCTAGACAGTGGACATGAGAAGG + Intergenic
921822409 1:219632336-219632358 TTCACACAGTCTTCATGATGAGG + Intergenic
924674163 1:246158979-246159001 TTCAGATAATGTTCATGATGTGG + Intronic
1066167982 10:32808521-32808543 TCCAGACAGTGTACATGATGTGG - Intronic
1066334220 10:34459957-34459979 TGGAGACAGTGTACCTGAGGAGG - Intronic
1066591437 10:36999305-36999327 AACAGAAAGTGTACATGATGTGG + Intergenic
1071231313 10:83589484-83589506 TACACACAGTGTCCATGTTGTGG - Intergenic
1077065820 11:640531-640553 TGAAGACAGTGTAGATGACGGGG - Exonic
1078916481 11:15783510-15783532 TCCAGACAGTGTCCTTGGTGGGG + Intergenic
1079222883 11:18579429-18579451 TCCAGACAGCTTAAATGATGAGG + Intronic
1080709864 11:34736815-34736837 TCCAGGCAGGAGACATGATGGGG + Intergenic
1082105575 11:48217652-48217674 TCCTGAGTGTGTAAATGATGGGG - Exonic
1084729467 11:71064273-71064295 TGCAGACAGTGGAGAGGATGCGG + Intronic
1085896859 11:80649968-80649990 AACAGAAAGTGTACATGATGTGG - Intergenic
1089588813 11:119527075-119527097 TCCAGACAGTGGGCATCAGGTGG + Intergenic
1097757360 12:63421597-63421619 TCAAGACAGTGTGCCTGAAGGGG - Intergenic
1099110741 12:78557358-78557380 TCCTGACAGTGTCTATGAAGGGG + Intergenic
1101829839 12:108248669-108248691 TCCAGCAAGTCTCCATGATGTGG - Exonic
1105611789 13:21975179-21975201 ACCAGACATTGTTCATGATGGGG - Intergenic
1106920763 13:34561077-34561099 TGCAGCCAGTGTACTTGCTGGGG + Intergenic
1112105040 13:96231118-96231140 TCCAGAATGTGTGCATGTTGAGG + Intronic
1113412269 13:110100843-110100865 TCCAGATAGGCTACTTGATGGGG - Intergenic
1121501347 14:94440952-94440974 TCCCTACAGTGTACATGAAGGGG - Intergenic
1121601884 14:95211314-95211336 TCCACACAGTGAACTTGCTGGGG + Intronic
1125337133 15:38637833-38637855 TCCAGAAAGAGTAAATAATGGGG - Intergenic
1128659821 15:69490684-69490706 TCCAGAGAATGAACTTGATGAGG + Intergenic
1130849740 15:87781221-87781243 TCCAGCCAGGGGAGATGATGTGG + Intergenic
1131297070 15:91158507-91158529 TGTAGTCAGTGTACATGATGTGG + Intronic
1141412437 16:83844881-83844903 TCCAGGCGGTGACCATGATGCGG + Intergenic
1141876194 16:86826192-86826214 TCCAGACAGAGCACCTGGTGTGG + Intergenic
1143215715 17:5223351-5223373 TACAGACACAGTACAGGATGAGG + Exonic
1143336612 17:6176246-6176268 GCCAGACATTGTACCTGCTGGGG - Intergenic
1145218855 17:21072352-21072374 CTCATACAGTGTAAATGATGTGG + Intergenic
1148972267 17:51494029-51494051 TCTAGACAGTGTTTATTATGGGG + Intergenic
1149170691 17:53807863-53807885 TCCATCCAGTGTACATGAAATGG + Intergenic
1151313823 17:73310339-73310361 TCCAGCGAGTGTAAATAATGAGG - Intronic
1152546435 17:81002363-81002385 TGCAGACAGTTTACAGGCTGGGG - Intronic
1163746469 19:19051753-19051775 TCCAGGCAGTGAAGATGATGGGG - Exonic
1167608522 19:50494618-50494640 AGCAGACAGTGTAGATGAAGCGG + Intergenic
1168103608 19:54153770-54153792 TCCACACCAAGTACATGATGTGG + Exonic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
927442909 2:23131947-23131969 GCCAGACAGTGTGGATGACGTGG + Intergenic
929899192 2:45986720-45986742 TCCAGCCACTGGACATGAGGAGG + Intronic
929967609 2:46547480-46547502 CCCAGGCAGTGCACATGATGGGG - Intronic
930155958 2:48107805-48107827 TCCGGACAGTGGATATGGTGAGG - Intergenic
937500291 2:122471087-122471109 TCCAGTCACCTTACATGATGGGG + Intergenic
937763077 2:125628652-125628674 TTCAGTCAGTGTACATGAGGAGG + Intergenic
940769023 2:157820630-157820652 TCCATGCAGTGAAGATGATGGGG - Intronic
942092249 2:172504572-172504594 TCCAGATAGTGTAGCTGAGGAGG + Exonic
944358883 2:198827743-198827765 TCCATAAAGTGTCCATGAAGTGG + Intergenic
944728296 2:202494933-202494955 TCCTGACAGGGTGCGTGATGCGG + Intronic
947307475 2:228763554-228763576 TCCTGACAGTATGAATGATGGGG + Intergenic
947693016 2:232157318-232157340 TACAGGCAGTGTACATGGTTTGG - Intronic
948748963 2:240118016-240118038 TTCAGAAAGTGTAGATGGTGGGG + Intergenic
1170466165 20:16624220-16624242 TGCAGGCAGTGTAGATGAGGTGG + Intergenic
1171346672 20:24470559-24470581 CCCAGAGAGTGCACATGAAGAGG - Intronic
1171814949 20:29777884-29777906 ACCAGGCAGTGCACATTATGGGG - Intergenic
1171903486 20:30878838-30878860 ACCAGGCAGTGCACATTATGGGG + Intergenic
1175274820 20:57761124-57761146 GCCAGACAGGGTGCATGAGGTGG - Intergenic
1178893599 21:36541119-36541141 TCCAGAGAGAGGACTTGATGTGG + Intronic
1179139824 21:38715105-38715127 TCCTGTCAGTGTACATCACGTGG + Intergenic
1180033027 21:45224940-45224962 TCCATCCAGTGTCCTTGATGTGG + Exonic
1180318389 22:11298434-11298456 GCCAGGCAGTGCACATTATGGGG - Intergenic
1180336883 22:11584797-11584819 ACCAGGCAGTGCACATTATGGGG + Intergenic
1181403126 22:22663883-22663905 TCCACACAGGGCACATGTTGTGG - Intergenic
1181597910 22:23929206-23929228 TGCACACAGTGTCCATGTTGGGG - Intergenic
1182332619 22:29561693-29561715 TCCTGACAGTGTGCCTCATGGGG + Intronic
949581554 3:5393403-5393425 TCCACACAGTGCCCAGGATGTGG - Intergenic
950945162 3:16937843-16937865 TACAGACTGAGTACATGACGTGG - Intronic
953959772 3:47257786-47257808 TCCTCACAGTCTACATGACGAGG - Intronic
954088230 3:48264046-48264068 ACCAGCCAGTGTACATCATCAGG + Intronic
955527076 3:59832072-59832094 TCCCTACAGTGCACATCATGGGG - Intronic
964880794 3:161420512-161420534 TGGATACAGTGTACATGCTGGGG - Intergenic
965955412 3:174363004-174363026 TCGAGAGAATGTACATCATGGGG + Intergenic
966627501 3:182034082-182034104 GCCAGATAGTGTACATGTTTTGG - Intergenic
967159411 3:186722204-186722226 GAAAGACAGTGTAAATGATGAGG - Intronic
967644341 3:191902948-191902970 TCCACACAGTGTTTATTATGTGG + Intergenic
969473401 4:7403852-7403874 TGCATACAGTGTACATTATTCGG - Intronic
975095180 4:70449551-70449573 CCCAGACAGTGAAGATGATATGG - Intronic
977466341 4:97386351-97386373 TGCAGACAATGTGCATGTTGCGG - Intronic
978843208 4:113239949-113239971 TCATGACAGTGTAAATGATGTGG + Intronic
980905467 4:138944439-138944461 TCCAGAAAATATACATGAGGAGG - Intergenic
986615279 5:9610522-9610544 TCCAGGCTGTGTGCATGCTGAGG + Intergenic
989772128 5:45157478-45157500 TCAAGACAGAGTACTTGATGGGG - Intergenic
991039210 5:62158903-62158925 TCCAGACAGAGTTCCTGCTGGGG + Intergenic
998568242 5:143234833-143234855 GGCAGACAGTGTTCATGCTGAGG - Intergenic
999874157 5:155783943-155783965 GCCATACAGTGGACATCATGAGG - Intergenic
1001403739 5:171461461-171461483 TCCAAACAATGCACAGGATGGGG - Intergenic
1002671657 5:180872572-180872594 CCCAGACAGGGCACATCATGGGG + Intergenic
1003011708 6:2433206-2433228 TCAAGACAGTTTGCAGGATGAGG - Intergenic
1006867234 6:37218730-37218752 TCCAGACAATGTAGATGACCAGG + Exonic
1009307045 6:62103403-62103425 CCCAGCCAGTGTGCATGCTGGGG - Intronic
1010739164 6:79479849-79479871 TCCAGACAGTGTGCAGTGTGAGG + Intergenic
1011728952 6:90240691-90240713 AGCAGACAGTCTACATGTTGAGG - Intronic
1017870257 6:158480930-158480952 TCCAGACAGAGCACAGGCTGGGG - Intronic
1018276567 6:162138470-162138492 TCCAGACATTGTACATTAGGTGG - Intronic
1027536930 7:79414997-79415019 TCCAGTAAGTTTAAATGATGTGG + Intronic
1030274133 7:107701421-107701443 TGCAGACACTGTTCATGGTGGGG - Intronic
1030582153 7:111371092-111371114 TACAGAAAGGATACATGATGAGG + Intronic
1031613884 7:123857852-123857874 TCCAGAAGGTGTACTTGAAGTGG + Intronic
1033434505 7:141320901-141320923 TCCAGGCAGTTCACAAGATGGGG - Intronic
1037350186 8:17945202-17945224 TCCAGACAGTTTACATCATTAGG - Intronic
1037888793 8:22610453-22610475 TCCTGACAATGTACAGGAAGCGG + Intronic
1038634535 8:29274972-29274994 TCCAGACAGTGAACACTTTGGGG - Intergenic
1040468031 8:47713260-47713282 TCCACACAGGGTAAATTATGTGG - Intronic
1044082170 8:87898620-87898642 TACAGAAGGTGTACAAGATGTGG - Intergenic
1048689666 8:136947380-136947402 TCCATACAGTGGGCATGGTGGGG - Intergenic
1050615567 9:7398435-7398457 TCAAGACAGTGTGAATTATGAGG + Intergenic
1050818238 9:9842766-9842788 CCCACACAGTCCACATGATGTGG + Intronic
1052866474 9:33467363-33467385 TCCTTCCAGTGTACATGCTGGGG + Intronic
1055375527 9:75645527-75645549 TTCAGTCAGGGGACATGATGGGG - Intergenic
1056260120 9:84840490-84840512 TCCAGCCAGTGCACATGGGGAGG - Intronic
1057819245 9:98318561-98318583 TCCAGATGGTGCACATGAGGAGG + Intronic
1059671628 9:116497619-116497641 TCCAGACAGTGGGGATGACGAGG - Intronic
1060344010 9:122800983-122801005 TCCAGAGGCTGTAGATGATGGGG - Exonic
1061691284 9:132333735-132333757 TCCAGATAGTCTAGATAATGAGG - Intronic
1203366615 Un_KI270442v1:264196-264218 GCCAGGCAGTGCACATTATGGGG - Intergenic
1187472196 X:19579390-19579412 TCCAGACACTGCCCAAGATGGGG - Intronic
1189470177 X:41307777-41307799 TCTACACAGTGGACATGTTGGGG + Intergenic
1190011372 X:46788004-46788026 TCAAGACTGTGTACATTCTGAGG - Intergenic
1190320205 X:49175620-49175642 TCCAGTCAGAGTAGATGATGAGG - Exonic
1192481364 X:71489139-71489161 TCCAGACACTGGACATCAGGCGG - Intronic
1193708322 X:84850361-84850383 TACTGTCAGTGTACATGAAGAGG - Intergenic
1198001761 X:132446437-132446459 TCCAGACACTGGAGAGGATGTGG - Intronic
1198639623 X:138742411-138742433 TCCAGATAGTGTAAATACTGAGG + Intronic
1201072062 Y:10156031-10156053 GCCAGACACTGCACATTATGGGG + Intergenic