ID: 1066170276

View in Genome Browser
Species Human (GRCh38)
Location 10:32836073-32836095
Sequence TACACAACTAAATTTAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066170275_1066170276 -8 Left 1066170275 10:32836058-32836080 CCACAATTCAGTGATTACACAAC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1066170276 10:32836073-32836095 TACACAACTAAATTTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066170276 Original CRISPR TACACAACTAAATTTAGTTC TGG Intronic
No off target data available for this crispr