ID: 1066172822

View in Genome Browser
Species Human (GRCh38)
Location 10:32869976-32869998
Sequence GCTACAGTAAGCAAAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 808
Summary {0: 1, 1: 5, 2: 120, 3: 189, 4: 493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066172822_1066172823 -7 Left 1066172822 10:32869976-32869998 CCATGCTCTTTGCTTACTGTAGC 0: 1
1: 5
2: 120
3: 189
4: 493
Right 1066172823 10:32869992-32870014 CTGTAGCCTTGTAGTATAGTTGG 0: 59
1: 58
2: 66
3: 55
4: 209
1066172822_1066172825 1 Left 1066172822 10:32869976-32869998 CCATGCTCTTTGCTTACTGTAGC 0: 1
1: 5
2: 120
3: 189
4: 493
Right 1066172825 10:32870000-32870022 TTGTAGTATAGTTGGAAGTCAGG 0: 60
1: 13227
2: 7637
3: 6182
4: 4966

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066172822 Original CRISPR GCTACAGTAAGCAAAGAGCA TGG (reversed) Intronic
900127417 1:1074660-1074682 GCAGCAGTGAGCAAAGGGCAGGG - Intergenic
900791596 1:4684429-4684451 GCTACAGGAAGGAGAGACCAAGG + Intronic
901717227 1:11165854-11165876 GCTACAGTAACCAAACAGCATGG + Intronic
904870881 1:33617402-33617424 GCTACAGTCACCAAAGAACAGGG - Intronic
904899266 1:33843706-33843728 CCAACAGGAAGCCAAGAGCAAGG - Intronic
905140337 1:35838627-35838649 TCTAGAGTAAGCAAACACCAAGG + Intronic
905330679 1:37194177-37194199 GCTATAGTAATCAAACAGCATGG + Intergenic
905655402 1:39683502-39683524 GATACACTAAGCAAAGTGCAGGG - Intronic
906454097 1:45978452-45978474 GTTGCAGTGAGCAAAGATCACGG + Intronic
906875729 1:49536663-49536685 GCTATAGTAACAAAATAGCATGG + Intronic
906879127 1:49570966-49570988 GCTATAGTAATAAAACAGCATGG - Intronic
906897324 1:49789940-49789962 GCTACAGTAACCAAACAGCATGG + Intronic
907223215 1:52922161-52922183 GTTACAGTGAGCCAAGATCAAGG - Intronic
907532430 1:55114502-55114524 GCTACAGTACCAAAACAGCATGG + Intronic
907794598 1:57702800-57702822 GCTATAGTAACCAAACAGCATGG + Intronic
908788440 1:67757647-67757669 GCAACAGTCAGTATAGAGCAAGG - Intronic
909438860 1:75674991-75675013 TCTACAGTAACCAAAGAGCATGG - Intergenic
909661418 1:78087357-78087379 GCTACAGTAACCAAACAGCATGG + Intronic
910083771 1:83373333-83373355 GGAGCAGTAAGCAAAGGGCAAGG + Intergenic
910612686 1:89162154-89162176 GCTACAGTAACCAAAATACATGG - Intronic
910950296 1:92639878-92639900 GCTACAGTAACCCAACAGCATGG + Intronic
911012277 1:93293371-93293393 GCTATAGTAACCAAACGGCATGG + Intergenic
911021180 1:93389397-93389419 GCTACAGTAACCAAAACACATGG - Intergenic
911022549 1:93403334-93403356 GCTACAGTAACCAAAATGCATGG - Intergenic
911235880 1:95411747-95411769 GCTACAGTTGGAAAAGGGCAGGG - Intergenic
911535281 1:99092305-99092327 GCCATAGTAACCAAACAGCATGG - Intergenic
911652643 1:100407079-100407101 GCTACAGTAACCAAACAACATGG - Intronic
911811710 1:102290855-102290877 GCTACAGTAATAAAACAGCATGG - Intergenic
911827462 1:102505562-102505584 GCTACAGTAACCAAAGCACTTGG - Intergenic
912148360 1:106822810-106822832 GCTATAATAACCAAACAGCATGG - Intergenic
912335792 1:108861392-108861414 GCTGCAGTAAGCTACGATCATGG - Intronic
912375455 1:109206074-109206096 GCTGCAGTGAGCCAAGATCATGG - Intronic
912462448 1:109845045-109845067 GCTACACTAGACAAAGAGCTAGG + Intergenic
912488120 1:110045413-110045435 GCTACAGTGAGCTATGATCATGG + Intronic
912970974 1:114282515-114282537 GCTACAGAGAGCAGAGTGCAAGG + Intergenic
913660423 1:121002057-121002079 CATACCGAAAGCAAAGAGCAGGG - Intergenic
914011787 1:143785214-143785236 CATACCGAAAGCAAAGAGCAGGG - Intergenic
914166046 1:145175920-145175942 CATACCGAAAGCAAAGAGCAGGG + Intergenic
914420600 1:147525265-147525287 GCTACAGTAAGTTAAGACAAGGG + Intergenic
914650415 1:149693873-149693895 CATACCGAAAGCAAAGAGCAGGG - Intergenic
915124917 1:153657208-153657230 GCTACAGTGAGCCAAGATCGTGG - Intergenic
916829790 1:168479111-168479133 GCTACAGTAATCAAAAAGCATGG + Intergenic
917142991 1:171856254-171856276 GCTACAGTAACCAAACAGCATGG - Intronic
917768159 1:178245948-178245970 GCTACAGTAACCAAACACCATGG - Intronic
917907907 1:179606824-179606846 GCTACAGTAACCAAATAGTGTGG - Intronic
918308907 1:183271442-183271464 CCCACAGAAAGCAAAGTGCACGG + Intronic
918629338 1:186697243-186697265 ACTACAGTAACCAAGCAGCATGG + Intergenic
918665801 1:187149197-187149219 GCTATAGTAACCAAACAGCATGG - Intergenic
918677532 1:187306076-187306098 GCTGCAGTAACCAAACAGCATGG + Intergenic
918983300 1:191591774-191591796 GCTGCAGTGAGCCAAGATCAGGG - Intergenic
919102558 1:193112422-193112444 GCTACAGTGAGCTGAGATCATGG - Intergenic
919120119 1:193329089-193329111 GCTATAGTAACCAAACAGCATGG - Intergenic
919186539 1:194158482-194158504 GCTACAGTAATAAAACAGTATGG - Intergenic
919630248 1:199953772-199953794 GCACCAGTAAGCAGAGAGCATGG + Intergenic
921286758 1:213616104-213616126 GGTGCTGTAAGCAAAGTGCAAGG + Intergenic
921783455 1:219197238-219197260 GCTACAGTAACCAAACAGCATGG + Intronic
922380732 1:225021889-225021911 ACTACAGTAACCAAACAGCATGG + Intronic
922446884 1:225705409-225705431 GTTACAGTAAGACAGGAGCAAGG - Intergenic
922843193 1:228661439-228661461 GCTACAGTAACCAAACAGCATGG + Intergenic
922880727 1:228978657-228978679 GGGACAGGAAGCAGAGAGCAGGG - Intergenic
923066253 1:230519985-230520007 CCCACACTCAGCAAAGAGCAAGG - Intergenic
923258299 1:232241477-232241499 GCTATAGTAACAAAACAGCATGG + Intergenic
923397163 1:233578215-233578237 GCTATAGTAAGCCATGATCATGG - Intergenic
923904810 1:238372040-238372062 GCAACAGTTTGCAAAAAGCAGGG + Intergenic
924129955 1:240896664-240896686 GCTGCAGTAACCAAACCGCATGG - Intronic
924919025 1:248606596-248606618 TATACAGTAACCAAACAGCATGG - Intergenic
1062794274 10:331681-331703 ACTGCAGAAAGCAAAGAGCGAGG - Intronic
1062817855 10:514208-514230 GCTAGAGTGAGCAAAGCCCAAGG - Intronic
1063243952 10:4199421-4199443 TCTACCTTAAGCCAAGAGCATGG + Intergenic
1065189927 10:23199384-23199406 GCTCCAGGAAGCAGCGAGCAGGG + Intergenic
1066172822 10:32869976-32869998 GCTACAGTAAGCAAAGAGCATGG - Intronic
1066460602 10:35608874-35608896 GCTGCAGTGAGCCAAGATCACGG + Exonic
1067451460 10:46384538-46384560 GCTAAGGTAAGCAAAGTGCCTGG - Intronic
1067579121 10:47429211-47429233 GCTACAGTAACCAAACAGCATGG - Intergenic
1067585779 10:47475218-47475240 GCTAAGGTAAGCAAAGTGCCTGG + Intronic
1068212599 10:53940520-53940542 GCTACTGTAGGCAATGATCATGG + Intronic
1068314741 10:55325330-55325352 GCTACAGTGACCAAATAGCATGG + Intronic
1068409904 10:56641251-56641273 GCTACAGTAACCAAAAAACATGG - Intergenic
1068586033 10:58799731-58799753 GCTACAGAAACCAAACAGCATGG - Intronic
1068750489 10:60586255-60586277 GCTACAGAGAGCAATCAGCAGGG + Intronic
1068946852 10:62738390-62738412 CCTACAGTAGGGGAAGAGCAAGG + Intergenic
1069122381 10:64583140-64583162 GCTACAGTAACAAAACAGCATGG - Intergenic
1069163616 10:65120684-65120706 GCTACAGTAATAAAACAGCATGG - Intergenic
1069226766 10:65954767-65954789 GCTACAGTAACCAAACAGCATGG - Intronic
1069344286 10:67449442-67449464 GCTATAGTAACAAAACAGCATGG + Intronic
1070213613 10:74352185-74352207 GCAACAATAACCAAACAGCATGG + Intronic
1070378738 10:75860203-75860225 CCAACAGCCAGCAAAGAGCAAGG - Intronic
1071247637 10:83782439-83782461 GCTACAGTAACCAAAACGCATGG - Intergenic
1071379092 10:85039852-85039874 GCTACAGTAACCAAGCAGCATGG - Intergenic
1071825777 10:89324138-89324160 GCTATAGTAACCAAAATGCATGG + Intronic
1072387405 10:94945271-94945293 GCTACAGTAACCAAACAGCATGG + Intronic
1072393929 10:95018840-95018862 GCTACAGTAACCAAACAGCATGG - Intergenic
1072493261 10:95929776-95929798 GCTACAGTAACCAAACAGCATGG - Intronic
1073054849 10:100692884-100692906 GATAAAATAAGGAAAGAGCATGG + Intergenic
1073218915 10:101853388-101853410 GCTACAGAAAGCAAAGTCCCAGG - Intronic
1073905023 10:108268630-108268652 GCTATAGTAATCAAAAAGCATGG - Intergenic
1074025687 10:109631489-109631511 GCTACAGTAACAAAACAGCATGG - Intergenic
1074447857 10:113534987-113535009 GCCACAGGAAGCAAAGGGAAGGG + Intergenic
1078039215 11:7842609-7842631 GCTACAGTAACCAAAACCCATGG - Intergenic
1078698182 11:13656004-13656026 TCTACAGTAACCAAAACGCATGG + Intergenic
1079760547 11:24324129-24324151 GTTGCAGTAAGCCAAGATCATGG + Intergenic
1079832675 11:25288468-25288490 GCTACAGTAACCAAATTGCATGG - Intergenic
1080216137 11:29843556-29843578 AATACAGGAAGCAAAGAGAAGGG - Intergenic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1080309785 11:30876391-30876413 TCAAGAGTAAGGAAAGAGCAGGG + Intronic
1080432182 11:32209361-32209383 GCTACAGGAAGAAAAGAGTAGGG + Intergenic
1081131955 11:39391489-39391511 CTTACAGTAACCAAACAGCATGG - Intergenic
1082135389 11:48543286-48543308 CCTACAGTAACAAAACAGCATGG - Intergenic
1082685638 11:56235739-56235761 ACTACAGTAATTAAATAGCATGG - Intergenic
1082702901 11:56455321-56455343 GCTATGGTAACCAAAAAGCAAGG - Intergenic
1082886556 11:58089533-58089555 GCTACAGTAATCAAAAAGCATGG - Intronic
1082966922 11:58975647-58975669 GCTACAGTAACCAAACAGCATGG + Intronic
1083154178 11:60812470-60812492 GCTACAGTAAAAATAGAGAAGGG - Intergenic
1083345717 11:61990046-61990068 GCTACAGTAACCAAACAGCATGG + Intergenic
1083917075 11:65754144-65754166 GCTATAGTAACCAAACGGCATGG - Intergenic
1084990070 11:72914500-72914522 GCCACAGCAACCAAACAGCATGG + Intronic
1084992868 11:72945159-72945181 GCTACAGTAACCAAACAGCATGG + Intronic
1085930823 11:81081302-81081324 GCTATAGTAATCAAACAGCATGG - Intergenic
1086196758 11:84149597-84149619 GCTACAGAAACCAAATAGCATGG - Intronic
1086608876 11:88729636-88729658 GCTGCAGTAACCAAAACGCATGG + Intronic
1086756675 11:90572637-90572659 GCTACAGTAACCAAAGTGCATGG - Intergenic
1087566134 11:99860678-99860700 GCTATGGTAACCAAACAGCATGG - Intronic
1087627208 11:100608786-100608808 GCTACAGTAACCAAATAGCTTGG + Intergenic
1087703360 11:101462194-101462216 GCTACAGTAACCAAACAGCATGG - Intronic
1088441216 11:109872683-109872705 GTTACAGTAATCAAACAGTATGG + Intergenic
1088567475 11:111187706-111187728 GCTACAGTAACAAAACAGCATGG + Intergenic
1088806133 11:113353843-113353865 GCTACAGTAACCAAAACACATGG - Intronic
1089028072 11:115292912-115292934 ATTACAGTATGCAAATAGCAAGG - Intronic
1089041358 11:115453303-115453325 GCTGCAGTGAGCCAAGATCAAGG + Intronic
1089089974 11:115864389-115864411 GCTAAAGTAACCCAAAAGCATGG - Intergenic
1092402920 12:8192575-8192597 GCTATAGTAACCCAACAGCATGG - Intergenic
1093135336 12:15443082-15443104 GCTACAGTACCAAAACAGCATGG + Intronic
1093273998 12:17101228-17101250 GCTACAGTAACCAAACAGCATGG + Intergenic
1093592888 12:20927234-20927256 AATACAGTAATCAAAAAGCATGG - Intergenic
1093649147 12:21622949-21622971 TCTGCAGTAACCAAACAGCATGG - Intergenic
1093940511 12:25049125-25049147 GCTACAGTAGCCAAATAGCATGG - Intronic
1094156324 12:27340485-27340507 GCAACAGTAACCAAAAAGCATGG - Intronic
1094225637 12:28042269-28042291 GCTACAGTAACCAAACAGCATGG - Intergenic
1094225833 12:28044805-28044827 GCTATAGTAACCAAACAGCATGG - Intergenic
1096043059 12:48537374-48537396 ACTATAGTAACCAAACAGCATGG + Intergenic
1096484014 12:51964837-51964859 GCTACAGTTATCAAACAGAATGG - Intronic
1097070915 12:56354328-56354350 GCTGCAGTCAGCAGGGAGCAGGG + Intronic
1097364283 12:58694097-58694119 GCTACAGGAACCAAACAGCATGG + Intronic
1097498070 12:60367939-60367961 GTTATAGTAAACAAATAGCATGG + Intergenic
1097944068 12:65346966-65346988 GCTACAGTAACAAAACAGCATGG - Intronic
1098068285 12:66643624-66643646 GCTGCAGTAAGCTAAGAGCCTGG - Intronic
1098349668 12:69545393-69545415 GCTACAGTAATCAAACAGCATGG + Intronic
1098641526 12:72844090-72844112 GCTACAGTAATCAAACAGCATGG + Intergenic
1098685221 12:73411090-73411112 GCTACAGTAACCAAACAGCATGG - Intergenic
1099477756 12:83128211-83128233 GCTACAGCTGGCAGAGAGCAAGG + Intronic
1099652838 12:85450581-85450603 ACTACAGTAATCAAACAGCATGG - Intergenic
1099945705 12:89241483-89241505 GCTATAGTAACCAAACAGTATGG - Intergenic
1100083989 12:90885331-90885353 GCTGCAGTGAGCAGAGATCATGG - Intergenic
1102683580 12:114706855-114706877 GATGAAGCAAGCAAAGAGCATGG - Intergenic
1103455962 12:121065658-121065680 GCTACAGTAAGTCAAGATTAAGG - Intergenic
1103640915 12:122351524-122351546 TTTACAGTTAACAAAGAGCAAGG - Intronic
1103765435 12:123276143-123276165 GCTGCAGTGAGCCAAGATCACGG + Intergenic
1105305511 13:19166067-19166089 GCTGTAGGAAGCAAAGGGCATGG + Intergenic
1106357265 13:28995281-28995303 GCTACAGTAACCAAACAGCACGG - Intronic
1106604746 13:31217811-31217833 GCTACAGTAACCAAACAGCATGG - Intronic
1107226161 13:38050146-38050168 GCTACAGTAACCAAACATCATGG + Intergenic
1107376809 13:39812443-39812465 GGCACAGAAAGCAAACAGCAAGG - Intergenic
1107487236 13:40840480-40840502 GCTACAGTAACCAAACAGCATGG + Intergenic
1107559730 13:41548094-41548116 ACTTTAGTAAGCAGAGAGCAGGG - Intergenic
1107696111 13:43001850-43001872 GCTTCAGTGAGCAGAGATCATGG + Intergenic
1107968416 13:45617754-45617776 GCTACACTAACCAAAAAGCATGG - Intergenic
1108529404 13:51314977-51314999 TCTACAGTTAACACAGAGCAGGG - Intergenic
1109018260 13:57049073-57049095 GCTACAGTAACCAAACAGCATGG - Intergenic
1109468706 13:62775885-62775907 GCTTCAGCAGGCAACGAGCATGG + Intergenic
1109540923 13:63777809-63777831 GCTACAGTAACCAAAACGCATGG - Intergenic
1109732836 13:66438170-66438192 GTTGCAGTAAGCCAAGATCATGG + Intronic
1110315254 13:74099282-74099304 GCTGCAGTGAGCTAAGATCAAGG + Intronic
1110337715 13:74351324-74351346 GCTACAGTCACCAAACTGCATGG + Intergenic
1110476626 13:75922728-75922750 GGTACAGTAATCAAAATGCATGG + Intergenic
1110510752 13:76347345-76347367 GCTACAGTAACAAAACAGCATGG + Intergenic
1111332456 13:86777613-86777635 GTGACAGTAACCAAACAGCATGG - Intergenic
1111411548 13:87883492-87883514 GCTACACTTAACAAAAAGCATGG + Intergenic
1111550254 13:89800103-89800125 GCTACAGTATCCAAAAAGTATGG - Intergenic
1111561521 13:89955240-89955262 GCTACAGTAATGAAACAGTATGG - Intergenic
1112163886 13:96897009-96897031 GCTACAGTGAGCCGAGATCATGG + Intergenic
1112833548 13:103483797-103483819 GCTACAGTAATCAAATAATATGG - Intergenic
1112908497 13:104453579-104453601 GTTACAGTAACCAAACAACATGG + Intergenic
1113234277 13:108252524-108252546 GTTACAGTAACAAAACAGCATGG - Intronic
1114282121 14:21202854-21202876 ACTGCAGTAAGCCAGGAGCAAGG + Intergenic
1114592921 14:23884685-23884707 GTTACAGAAAGAAAAGAGCTTGG + Intergenic
1114706400 14:24731258-24731280 GCTATAATAACCAAACAGCATGG + Intergenic
1114794712 14:25700483-25700505 AGTAGAGTAAGCAAAGAGAAGGG - Intergenic
1115943484 14:38634730-38634752 GCTACAGTAACCAAACAGCTTGG + Intergenic
1116222486 14:42106316-42106338 GCTACAGTAACCAGACAGCATGG - Intergenic
1116897076 14:50326977-50326999 GCTGCAGTAAGCTATGATCACGG + Exonic
1117080430 14:52146229-52146251 GCTGCAGTAACCAAACAGCATGG - Intergenic
1117624893 14:57625561-57625583 GCTACAGAAACCAAACAGCATGG + Intronic
1117628873 14:57668711-57668733 GCTACAGTAACCAAACAGCATGG - Intronic
1117851165 14:59971311-59971333 TCTACAGTAAGAAAACGGCATGG - Intronic
1118504531 14:66396591-66396613 GCTACAGTACCAAAACAGCATGG + Intergenic
1119121321 14:72080899-72080921 GCTACAGTAATCAAAATGCATGG - Intronic
1120200348 14:81532224-81532246 ACTACAGTAATGAAAGAGCACGG - Intronic
1120202089 14:81548334-81548356 GCTGCAGTAACCAAAAAGCATGG + Intergenic
1121130832 14:91445740-91445762 GCTATAATAACCAAACAGCATGG + Intergenic
1122589215 14:102834211-102834233 GCTACAGCAACCTAACAGCATGG + Intronic
1123842698 15:24265064-24265086 GATAAAGTAACCAAACAGCATGG - Intergenic
1123852267 15:24371070-24371092 GATAAAGTAACCAAACAGCATGG - Intergenic
1123857738 15:24431089-24431111 GATAAAGTAACCAAAAAGCATGG - Intergenic
1123862366 15:24481647-24481669 GATAAAGTAACCAAACAGCATGG - Intergenic
1124151840 15:27187304-27187326 GCTACAGTAACCAAAATGCATGG - Intronic
1124450270 15:29782307-29782329 GCTACAGTAACCAAACAGCATGG + Intronic
1124714515 15:32047050-32047072 GCTACAGTAACCAAACAGCATGG - Intronic
1125238363 15:37543458-37543480 GCTCTAGTAACCAAACAGCAAGG + Intergenic
1125653751 15:41338901-41338923 GCTGCAGTGAGCCAAGATCACGG + Intronic
1126062742 15:44799586-44799608 GACACAGAAAGCAAAGAGCAAGG - Intergenic
1126207826 15:46066040-46066062 GCTATAGTAATTAAACAGCATGG + Intergenic
1126246605 15:46513499-46513521 GCTATAGTAATCAAATAGCGTGG - Intergenic
1126285580 15:47007203-47007225 GCTACAGTAATGAAACAGCATGG - Intergenic
1126995138 15:54434346-54434368 GCTATAGTAACCAAACAGCATGG + Intronic
1127158497 15:56154391-56154413 GCTACAGTAACCAAACAGCATGG + Intronic
1127406422 15:58652617-58652639 GCTATAGTAACCAAACAACATGG - Intronic
1127887395 15:63214351-63214373 GCTACAGTGAGCCGAGATCATGG - Intronic
1128230829 15:66033851-66033873 GTTGCAGTAAGCCAAGATCATGG - Intronic
1128628895 15:69242993-69243015 GCTACAGTGAGCTATGAGCATGG + Intronic
1128892704 15:71345086-71345108 GCTACACTAAGAAAGGATCAAGG - Intronic
1129075040 15:72987250-72987272 GCTGTTGTAATCAAAGAGCATGG + Intergenic
1131159404 15:90094838-90094860 GTTGCAGTAAGCCAAGATCACGG + Intronic
1134288642 16:12884524-12884546 GTTATAGTAATCAAACAGCATGG - Intergenic
1134420402 16:14082419-14082441 GTTATAGTAACCAAACAGCATGG - Intronic
1134505781 16:14805726-14805748 GCTCCTGTGAGCAAAGAGGATGG + Intronic
1134574800 16:15323221-15323243 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1134617376 16:15661993-15662015 GCTGCAGTAAGCTATGATCACGG - Intronic
1134727645 16:16433253-16433275 GCTCCTGTGAGCAAAGAGGATGG + Intergenic
1134939787 16:18278574-18278596 GCTCCTGTGAGCAAAGAGGATGG - Intergenic
1134988781 16:18680010-18680032 CATACAGCAAGCAAAAAGCAAGG + Intergenic
1135301349 16:21330403-21330425 GCTGCAGTAGCCAAACAGCATGG - Intergenic
1135827148 16:25738820-25738842 GCTACAGTAATCAGAGAGTATGG - Intronic
1137790759 16:51172802-51172824 GCTACAGTGAGCTATGATCATGG - Intergenic
1138997008 16:62467739-62467761 GCTACAGAAACCCAACAGCATGG - Intergenic
1139191468 16:64868149-64868171 GCTGCAGTGAGCCAAGATCATGG + Intergenic
1139509731 16:67420372-67420394 GCTGCAGTGAGCCAAGATCACGG - Intergenic
1140404635 16:74700615-74700637 GGTACAGTCAGCAGAGTGCAGGG - Exonic
1140738196 16:77917859-77917881 GCTCCCCTAAGCAAAGACCAGGG - Intronic
1140846462 16:78893284-78893306 GCCACAGTAAGCACAGAGTCAGG + Intronic
1140883829 16:79225122-79225144 GCTACAATAACTAAAAAGCATGG + Intergenic
1140886098 16:79244827-79244849 GCTACAGTAACAAAACAGCCTGG + Intergenic
1140949853 16:79806664-79806686 GCTACATAAATCATAGAGCAAGG - Intergenic
1143475023 17:7197544-7197566 GCTGCAGTGAGCCAAGATCACGG - Intronic
1144383074 17:14722202-14722224 GCTGCAGTAACCAAAACGCATGG + Intergenic
1144438190 17:15259874-15259896 GTTGCAGTAAGCCAAGATCATGG + Intronic
1144471607 17:15547449-15547471 GTCACAGTAACCAAATAGCAAGG - Intronic
1144793482 17:17875192-17875214 GGTTCAGTAAGCCAAGATCATGG + Intronic
1144924870 17:18797256-18797278 GTCACAGTAACCAAATAGCAAGG + Intronic
1146088369 17:29851528-29851550 GTTACAGTGAGCCAAGATCATGG + Intronic
1146755222 17:35425233-35425255 GCTGCAGTAAGCGATGATCATGG + Intronic
1147252960 17:39164776-39164798 GCTAGAGGGAGCGAAGAGCAGGG + Intronic
1148606828 17:48935927-48935949 GCTGCAGTAAGCAATGATCTTGG + Intronic
1148749700 17:49938280-49938302 GTTGCAGTAAGCCAAGATCATGG + Intergenic
1149648480 17:58258522-58258544 GCTATAGCAACCAAACAGCATGG - Intronic
1150151645 17:62814172-62814194 GCTATAGTAACCAAAGCACATGG - Intergenic
1153351804 18:4089561-4089583 GCTACAGTAACCAAACAGCATGG + Intronic
1153550847 18:6260170-6260192 GCTACAGAAACCAAACAGCATGG - Intronic
1154932651 18:21016428-21016450 GATAAAGTAAACAAAGAGAAAGG + Intronic
1155178685 18:23324263-23324285 CCAAGAGTAAGCCAAGAGCAAGG - Intronic
1155716894 18:28954886-28954908 GCTACAGTAACTAAACAACATGG + Intergenic
1156601407 18:38611506-38611528 GCTACAGTAAGACAGGAGCAGGG + Intergenic
1157713162 18:49863845-49863867 ACTTCAGAAAGCAAACAGCAAGG + Intronic
1158221292 18:55153659-55153681 GTTACAAGAAACAAAGAGCAGGG - Intergenic
1158431814 18:57395523-57395545 GCTACAGTAACAAAGTAGCATGG + Intergenic
1158856580 18:61548741-61548763 ACTACAGCAAGGAAAGAGCATGG + Intronic
1159571191 18:70113734-70113756 GCTACAGTATGCAAGGAGCTTGG + Intronic
1159694395 18:71536691-71536713 GCTACAGTAACAAAACAACATGG - Intergenic
1160108270 18:76000436-76000458 GCTACAGTAACAAAATAGCATGG - Intergenic
1161616862 19:5275742-5275764 GCTGCAGTGAGCCAAGATCATGG + Intronic
1161697920 19:5780464-5780486 GCTGCAGTAAGCCATGATCACGG + Intergenic
1163183176 19:15618271-15618293 ACTACAGGAAGGAAAGAGGAAGG - Intronic
1163399043 19:17080805-17080827 GCTACAGTGAGCTATGATCATGG + Intronic
1163886840 19:19973094-19973116 GCTACAATAAGCAAACGGCATGG - Intergenic
1163950299 19:20578066-20578088 GCTACAGAAAGCAAATAGCATGG - Intronic
1163967694 19:20763344-20763366 GCTACAGTAAGCAAATAGCATGG + Intronic
1164326670 19:24199158-24199180 GCTACAGTAACCAAACAGCATGG - Intergenic
1164333100 19:24279899-24279921 GCTATAGTAACCAAACAGCATGG + Intergenic
1164467406 19:28499560-28499582 GCTGCAGTGAGCTATGAGCATGG - Intergenic
1164522019 19:28986708-28986730 GCTACAGGAAGCAAACCGAAGGG + Intergenic
1164600171 19:29557142-29557164 GCTACAGTAACCAAACAGCATGG + Intronic
1165877261 19:39017181-39017203 GCTCCAGTAAGCCAAAATCATGG + Intronic
1166009912 19:39934620-39934642 GCTGCAGTAGGAAAAGAGAAAGG + Exonic
926335189 2:11857558-11857580 GCCACAGTATTCAAGGAGCAGGG + Intergenic
926502235 2:13670573-13670595 GCGACAGTAACCAAACAGCTTGG - Intergenic
929182156 2:39053089-39053111 GTTACAGTGAGCCAAGATCACGG + Intronic
930270161 2:49246930-49246952 GCTACAGTAACCAAACAGCATGG + Intergenic
930350885 2:50252792-50252814 GCTACAGTAACCAAACAGCATGG - Intronic
930407046 2:50971883-50971905 GGTAGAGTAAGCAATGGGCAGGG - Intronic
930835534 2:55789495-55789517 GCTACAGTAACCAAACAGCATGG - Intergenic
930859778 2:56059293-56059315 GCTATAGTAACCAAACAGCATGG - Intergenic
931557832 2:63524363-63524385 GCTACAGTAACCAAACAGCATGG + Intronic
932224285 2:70027194-70027216 GCTGCAGTAAGCCAAGATCCTGG + Intergenic
932560223 2:72861248-72861270 GATACAGTGAGCAAAGTGGAGGG + Intergenic
932880473 2:75496798-75496820 GCTACAGTAAGCAAACAGTATGG + Intronic
933282199 2:80344544-80344566 GCTTCAGTGAGCCAAGATCATGG - Intronic
933530100 2:83497730-83497752 GCGACAGTAATCAAACAGCATGG - Intergenic
933545625 2:83707579-83707601 GCTACAGTAACCAAACAGCATGG - Intergenic
933559858 2:83875915-83875937 CATACAGGAAGCAAAGTGCAGGG + Intergenic
935295711 2:101647517-101647539 GCTACAGTGAGCTATGATCAGGG + Intergenic
935326263 2:101940410-101940432 GTTACAGTAACCAAACAACATGG + Intergenic
935727074 2:106032690-106032712 GTTACAGTAAGCTGAGAACATGG + Intergenic
935787907 2:106565882-106565904 GCTTCATAAAGTAAAGAGCATGG - Intergenic
935803074 2:106718003-106718025 GCCACAGTAATCAAACAGCATGG - Intergenic
936003476 2:108859681-108859703 GCTATAGTAACCAAACACCATGG - Intronic
937603125 2:123763467-123763489 GCTATGGTAACCAAACAGCATGG - Intergenic
938462400 2:131506320-131506342 GCCATAGGAAGCAAAGGGCATGG - Intergenic
938651092 2:133384437-133384459 GCTACAGTAACCAAACAGCATGG - Intronic
938822182 2:134969990-134970012 GCTACAGTAACCAAACAGCATGG - Intronic
939036300 2:137135254-137135276 GCTAAAGAAAGCTAAGAGAATGG - Intronic
939111123 2:138008536-138008558 GGTACAATAACCAAACAGCATGG + Intronic
939128867 2:138210487-138210509 GTTACAGTAAGCATAGCTCAAGG - Intergenic
939782021 2:146460704-146460726 GCTACACTAACCAAACAGCATGG - Intergenic
940014616 2:149090713-149090735 GTTACATTAAGCAAATAGAAGGG + Intronic
941077819 2:161026210-161026232 GCTACAGTACCAAAACAGCATGG + Intergenic
941116233 2:161475586-161475608 GCTACAGTAACCAAACAGCATGG + Intronic
941445571 2:165594503-165594525 GCTTCAGTAAGCAGGTAGCATGG + Intronic
941715553 2:168759630-168759652 GCTAAAGTAAGTACAGGGCATGG - Intronic
941858988 2:170259323-170259345 GTTACAGTAGCCAAAAAGCATGG + Intronic
942855007 2:180534982-180535004 GCTACATTCAGGGAAGAGCAGGG - Intergenic
943155307 2:184167891-184167913 GCTACAGTAACCAAAGAGCATGG - Intergenic
943200799 2:184821174-184821196 GCTGCAGTAACCAAACAGCATGG + Intronic
943206934 2:184911350-184911372 GCTTCAGTAACCAAACAACATGG - Intronic
943268586 2:185769951-185769973 TCTACAGTAACCAAACAGCATGG - Intronic
943286933 2:186013533-186013555 GCTACAGTAACCAAACAGCATGG + Intergenic
943351421 2:186801097-186801119 GATACAGTAACCAAACGGCATGG - Intergenic
943837269 2:192529255-192529277 GTTACAGTAACCAAAAAACATGG + Intergenic
943858014 2:192823789-192823811 GTTGCAGTAAGCCAAGATCATGG + Intergenic
944360899 2:198855115-198855137 GCTACAGTAACCAAACAGCATGG + Intergenic
944397982 2:199291257-199291279 TCCAAAGTAAGCAAAGAGAATGG + Intronic
944535473 2:200705429-200705451 GCCACAGTAATCAAAGAGGAGGG - Intergenic
945040218 2:205737838-205737860 GCTACTGTAAGCAGAGATTAGGG + Intronic
945750158 2:213771830-213771852 GCTACAGTAACCAAACAGCATGG - Intronic
945758481 2:213880854-213880876 GCTACAGTAACCAAATGGCATGG - Intronic
945943379 2:215971737-215971759 GCTACAGTAAGTTGAGAGCAGGG - Intronic
946204904 2:218097589-218097611 GCTACAATTACCAAACAGCATGG - Intergenic
946240618 2:218352512-218352534 GCCACAGTAACCAAACAGCATGG - Intergenic
946258443 2:218464778-218464800 ACTACATAAAGAAAAGAGCAAGG + Intronic
947183775 2:227436162-227436184 TCAACAGTAAGTAAAGAACAAGG - Intergenic
947203344 2:227636939-227636961 GTTACAGTAAGAAAATAACAAGG + Intergenic
947902427 2:233732687-233732709 GCTACAGTAACAAAACAGCATGG - Intronic
948662191 2:239514489-239514511 GAGACGGTGAGCAAAGAGCAAGG - Intergenic
1169206050 20:3740907-3740929 TCTCCAGTAAGCCCAGAGCAGGG + Exonic
1169431802 20:5542817-5542839 GCTACATTAAGAATATAGCAGGG - Intergenic
1169711057 20:8564105-8564127 GCTACAGTAACCAAACAGTGTGG + Intronic
1170499438 20:16959891-16959913 GCTACAGTAAGCAAATAGCATGG + Intergenic
1170801616 20:19595103-19595125 GCTAGAGTAAGAAAACAGCAAGG + Intronic
1170891261 20:20377714-20377736 GCCACAGTAAGCCATGATCATGG - Intergenic
1171241554 20:23571597-23571619 GATACAGTAACCGAACAGCATGG - Intergenic
1173299426 20:41788382-41788404 GCTATAGTAACCAAATAGCATGG - Intergenic
1173882229 20:46424162-46424184 ACTACAGTTAGACAAGAGCAAGG - Intronic
1174000622 20:47371838-47371860 GCTGCAGTAAGCTATGATCATGG + Intergenic
1174028120 20:47596645-47596667 GCTGCAGTAAGCCAAGATCATGG - Intronic
1176908991 21:14539903-14539925 ACTACAGTAACAAAACAGCATGG + Intronic
1176985525 21:15431576-15431598 GGTACAGCAGCCAAAGAGCATGG + Intergenic
1177024158 21:15901246-15901268 GCTATAGTAACCAAACAGCATGG + Intergenic
1177071565 21:16515224-16515246 GCTATAGTAACCAAACAACATGG - Intergenic
1178026242 21:28471500-28471522 ACTACAGTAACCAAACAGCAAGG + Intergenic
1178212209 21:30548657-30548679 GCTACAGTAACAAAACAGCATGG - Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181113517 22:20616412-20616434 GCTACAGGAAGCAAAGGGCATGG + Intergenic
1181809890 22:25397369-25397391 GCTACATTAAGCCATGATCATGG - Intronic
1182991985 22:34777069-34777091 GCTAGAGTAAGAAAAGTGAAGGG + Intergenic
1183758538 22:39793839-39793861 GCTGTAGTAACCAAACAGCATGG - Intronic
1184273421 22:43397452-43397474 GGCACAGTAAGCAGAGGGCATGG + Intergenic
1184307091 22:43611921-43611943 ACTACAGTAACCAAACAGTATGG + Intronic
949176257 3:1066410-1066432 ACTACAGTAACCAAACAGCATGG + Intergenic
949224070 3:1672263-1672285 GCTACAGTAACCAAAACGCATGG - Intergenic
949305462 3:2635637-2635659 GCCACAATAGGCAATGAGCAGGG - Intronic
949506603 3:4734236-4734258 ACTACAGAAAGTAAAGAGAATGG - Intronic
949667848 3:6361951-6361973 GCTACAGTAATCAAACAGCATGG + Intergenic
950310435 3:11953315-11953337 GCAACAGTAAGCAAAAAGCTGGG - Intergenic
950598443 3:14007907-14007929 GCTACAGTAAGCAAACAGCATGG - Intronic
950758089 3:15194348-15194370 GCTACAGTAACCAAACAGCATGG + Intergenic
951917248 3:27815089-27815111 GCTCCAGTAAGCTAAAAGAAAGG + Intergenic
951939668 3:28063862-28063884 GCTACAGTAACCAAACAGCATGG + Intergenic
952525218 3:34203009-34203031 GACACAGAAAGCAAACAGCAAGG + Intergenic
952751636 3:36829662-36829684 GCTTCAGAAACCAAAGAACATGG + Exonic
953157890 3:40391612-40391634 GCTGCAGTGAGCCAAGATCACGG + Intronic
954197915 3:49007305-49007327 GCTACAGGTAGCAGAGACCAGGG - Exonic
954585972 3:51737133-51737155 GCTACAGTAATCAAAACACATGG - Intergenic
955378447 3:58417459-58417481 GCTACAGTAAGAAAAGGGAGGGG - Intronic
955425297 3:58783039-58783061 GCTATAGTAACCAAACAGCATGG + Intronic
955442245 3:58969088-58969110 GCTACAGTAACCAAAACGCATGG - Intronic
956073546 3:65480471-65480493 GATACAGTAAGCAGAGATCGTGG + Intronic
956092685 3:65684761-65684783 GCTACAGTGAGCTGAGATCATGG - Intronic
957354292 3:79061611-79061633 GCTACAGTAACCAAATAGCATGG + Intronic
957566607 3:81892176-81892198 GCTACATTAGGAAAAGAGCTTGG + Intergenic
957747212 3:84361311-84361333 GCTACAGTAACCAAACAGCATGG - Intergenic
958013570 3:87912699-87912721 GCTACAGTAACAAAACAGCATGG + Intergenic
958533982 3:95371728-95371750 GCTATAATAACCAAACAGCATGG - Intergenic
958562778 3:95769297-95769319 GCTACAGTAACCAAACAGCATGG + Intergenic
958601818 3:96304193-96304215 TCTTCAGGAAGCAAAGAGAATGG + Intergenic
959435795 3:106313618-106313640 GCTATAGTAACCAAAGAAAATGG - Intergenic
959463335 3:106653407-106653429 GTTACAGTAAACAAACAGCATGG + Intergenic
959547033 3:107608444-107608466 GCTATAGCAACCAAACAGCATGG - Intronic
960212680 3:114989482-114989504 GCTACAGTAACCAAACAGCATGG - Intronic
960276334 3:115733532-115733554 GCTACAGTAACCAAAAAGCACGG - Intergenic
960278013 3:115749142-115749164 GCTACAGTAACCAAAAAGCACGG + Intergenic
960342548 3:116491876-116491898 GCTACAGCAAGAAAACAGCATGG + Intronic
960531974 3:118775159-118775181 TCTATAGTAACCAAACAGCATGG + Intergenic
961716768 3:128863012-128863034 GCTGCAGTGAGCCAAGATCATGG + Intergenic
962123103 3:132585104-132585126 GCTACAGTAACCAAACAGCATGG + Intronic
963475377 3:145797227-145797249 GCCACAGTAACCTAAAAGCATGG - Intergenic
963630811 3:147727897-147727919 GCTACAGTACCAAAACAGCATGG + Intergenic
963650586 3:147974786-147974808 GATTCAGTAAGTAAAGAGTAAGG + Intergenic
963760437 3:149282850-149282872 GCTCCAGCATGTAAAGAGCATGG + Intergenic
964084998 3:152806448-152806470 CCTACAAGAAGCAAAGAGAAGGG - Intergenic
964273614 3:154985476-154985498 GCTACAGTAACCAAACAGCATGG + Intergenic
964560831 3:157994194-157994216 GCTACAGTAACCAAAGCAGAAGG + Intergenic
964567160 3:158069363-158069385 GCTACAGTAACCAAATAGCATGG + Intergenic
964576524 3:158176411-158176433 GCTACAGTAACCAAAAAGCATGG + Intronic
964833898 3:160915669-160915691 GCTACAGTAACCAAACAGCATGG + Intronic
964966803 3:162504256-162504278 GCTACAGTAACCAAACAGCATGG + Intergenic
965093915 3:164197782-164197804 GCTACAGTAACTAAATAACATGG + Intergenic
965137134 3:164786170-164786192 GCTACAGTAACGAAAAAGCATGG - Intergenic
965566188 3:170120760-170120782 GCTAAAGAAAGCAGAGAGCAAGG + Intronic
966045784 3:175547175-175547197 GTTATAGTAACCAAACAGCATGG + Intronic
966091122 3:176137794-176137816 GCTACGGTAACCAAACAGCATGG - Intergenic
966290918 3:178358574-178358596 GCTGTAGTAACCAAAAAGCATGG + Intergenic
966296070 3:178424756-178424778 GCTGCAGTAACCAAACAGCATGG + Intronic
966512020 3:180775152-180775174 GCTACAGTAATCAAAACTCATGG - Intronic
966972495 3:185057989-185058011 GTTATAGTAACCAAACAGCATGG + Intergenic
967398616 3:189035047-189035069 GCTACGGTAACAAAACAGCATGG + Intronic
967516506 3:190375538-190375560 GCTACACAAAGCAGATAGCAGGG + Intronic
967580426 3:191146728-191146750 GCTAATGTAACCAAAAAGCATGG - Intergenic
969777729 4:9371054-9371076 GCTACAGTTACCCAACAGCATGG + Intergenic
970101592 4:12528902-12528924 GCTACAGTAACAAAATAGCATGG + Intergenic
970365860 4:15357466-15357488 GCTGCAGTAACAAAACAGCATGG - Intronic
970997957 4:22289664-22289686 GCTACAGTAACCAAAACACAAGG - Intergenic
971294935 4:25379636-25379658 GCTGCAGAAAGCACAGAGGAAGG + Intronic
972807057 4:42539563-42539585 GCTATAGTAACCAAACAACATGG + Intronic
972859992 4:43156045-43156067 GTTACAGTAACCAAACAGCATGG - Intergenic
972948180 4:44284239-44284261 GGTACAGTAACCAAACAGCATGG + Intronic
973303721 4:48619219-48619241 GGCACAGTAAGCAAAGAATAAGG + Intronic
973559015 4:52115666-52115688 GCTGCAGTGAGCTAAGATCAAGG - Intergenic
973706036 4:53581424-53581446 AATACAGTGAGCAAAGAGGAAGG - Intronic
973764795 4:54153261-54153283 GCTACAGTGAGCTATGATCATGG - Intronic
974222397 4:58992719-58992741 GCTACAGTAACCAAACAGCATGG + Intergenic
974284495 4:59846559-59846581 GCTACAGTAACCAAACAGCATGG + Intergenic
974444126 4:61956917-61956939 ACTACAGTAACCAAAAAGCATGG - Intronic
974545371 4:63299439-63299461 GCTACAGTAACAAAACAGCATGG + Intergenic
974968421 4:68794584-68794606 GCAACAGCAACCAAACAGCATGG - Intergenic
975001950 4:69235483-69235505 GCTACAGCAACCAAACAGCATGG + Intergenic
975003484 4:69256609-69256631 GCTACAGCAACCAAACAGCATGG - Intergenic
975194336 4:71506071-71506093 GCTACAGAAACCAAACAGCATGG - Intronic
975234757 4:71979631-71979653 GCTACAGTAACCAAATAGCGTGG - Intergenic
975237363 4:72015091-72015113 AGTACAGTATGCAAAGAGGAGGG - Intergenic
975304030 4:72826952-72826974 GCTACAGTAACCAAAATGCATGG + Intergenic
976128847 4:81862535-81862557 ACTACAGTAACAAAACAGCATGG + Intronic
976220984 4:82756718-82756740 GCTACAAGTAGGAAAGAGCATGG - Intronic
976372491 4:84305200-84305222 GCTATAGTAACCAAAGAGCATGG + Intergenic
976793188 4:88903352-88903374 GCTACAGTAACCAAACAGCATGG + Intronic
977001564 4:91511205-91511227 GCTACAATAACAAAACAGCATGG - Intronic
977088837 4:92642978-92643000 GCTACAGTAACCAAATAGCATGG - Intronic
977106308 4:92889876-92889898 GCTACAGTAACCAAACAGCATGG + Intronic
978021272 4:103816026-103816048 GCTACAGTACCCAAACAGCTTGG + Intergenic
978277013 4:106964047-106964069 GCTATAGTAACCAAAAAGCATGG - Intronic
978600429 4:110421554-110421576 GCTACAGTAACCAAACAGCATGG + Intronic
978732759 4:112049394-112049416 ACTACAGTAACCAATGAGAATGG + Intergenic
979087672 4:116434260-116434282 GCTACAGTAACCAAACCGCATGG - Intergenic
979220608 4:118219301-118219323 GCCACAGTAACAAAACAGCACGG + Intronic
979267587 4:118721224-118721246 GCTACAGTAAGCACACAGCAGGG - Intergenic
979413843 4:120411996-120412018 GCTATAGTAAGCAAAATGAATGG + Intergenic
979634414 4:122941014-122941036 GCCACAGTAACCAAACAGCATGG - Intronic
979639723 4:122999689-122999711 GCTACAGTAACCAAACAGCATGG - Intronic
979644187 4:123048240-123048262 GCTACAGTAATAAAACAGCATGG - Intronic
980044678 4:127974431-127974453 GCTACAGTGAGCCAAGATCATGG - Intronic
980190122 4:129513975-129513997 GCAACAGTAAGCAAATAGGGGGG + Intergenic
980443568 4:132879205-132879227 GTTATAGTAACCAAACAGCATGG + Intergenic
980509568 4:133767546-133767568 GCTACAGTAACCAAAAAGCATGG - Intergenic
980568214 4:134573745-134573767 GCTACAGTAACAAAACAGCATGG + Intergenic
980696413 4:136362304-136362326 GCCACAGTAACCATATAGCATGG + Intergenic
981010857 4:139923235-139923257 GCTCCACCAAGCAAACAGCAAGG + Intronic
981133495 4:141184906-141184928 GCTACAGTAACCAAACAGCATGG - Intronic
981201777 4:141988459-141988481 TCTACAGTAACCAAAACGCATGG - Intergenic
982344972 4:154347325-154347347 GATGGAGTAAGAAAAGAGCATGG + Intronic
982613305 4:157606069-157606091 GCTAGAGTAATCTAACAGCATGG + Intergenic
982646548 4:158031129-158031151 GATACAGTAACCAAACAGCATGG + Intergenic
982684774 4:158474830-158474852 GTTACAGTAACCAAACAGCATGG - Intronic
982925358 4:161330634-161330656 GCTCCAGTGAGCAAAGGGTATGG + Intergenic
983137724 4:164105375-164105397 GCTGCAGTAACAAAACAGCATGG + Intronic
983138897 4:164123560-164123582 GCTATAGTAACCAAGCAGCATGG + Intronic
983251645 4:165352609-165352631 GTTACAGTAAGCAGACAGCGTGG + Intergenic
983333976 4:166368534-166368556 GCTACAGTGATCAAACAGCATGG - Intergenic
983419829 4:167502969-167502991 GCTACAGTAAACAAACAGCATGG - Intergenic
983423069 4:167545654-167545676 CCTACAGTAAGAAAACAGCATGG - Intergenic
983458168 4:167991359-167991381 GCTACAGTGAGCCATGATCATGG - Intergenic
983654015 4:170062796-170062818 GCTACAAAATGGAAAGAGCATGG - Intronic
983754029 4:171311383-171311405 GCTACAGTAACCAAACAGCATGG - Intergenic
983842786 4:172478274-172478296 GCTGTAGTAACCAAACAGCATGG + Intronic
984324507 4:178234944-178234966 GCTACAGTAACCAAACAGCATGG - Intergenic
984354617 4:178641734-178641756 GCTACAGTAACCAAACAGCATGG + Intergenic
984796273 4:183663126-183663148 GCTCCAGTGAGCCAAGATCACGG - Intronic
985356110 4:189121416-189121438 GCCATAGTCAGCAAAAAGCATGG + Intergenic
985360091 4:189165559-189165581 GCTCCTTTGAGCAAAGAGCATGG - Intergenic
985367851 4:189252157-189252179 GCTACATTTACCAAACAGCAAGG + Intergenic
985704605 5:1393085-1393107 GCTGCAGTTAGCACAGAGGATGG - Exonic
985815109 5:2122171-2122193 GCTATAGTAATAAAACAGCATGG - Intergenic
986080687 5:4389651-4389673 GCTACAGTAATCAAACACTATGG - Intergenic
986206564 5:5630181-5630203 GCCAGAGGAAGGAAAGAGCAAGG + Intergenic
986463800 5:8000418-8000440 GCTATAGTAATCAAACAGCGTGG - Intergenic
987152036 5:15051949-15051971 GTTATAGTAACCAAACAGCATGG - Intergenic
987230238 5:15886385-15886407 GCCATAGTGAGAAAAGAGCAAGG - Intronic
987893601 5:23916224-23916246 GCTGCAATAACCAAAGAGCATGG + Intergenic
988261812 5:28895866-28895888 GCTGCAGTAAGCTGAGATCATGG + Intergenic
988362247 5:30251717-30251739 GCTACTGTAATGAAATAGCATGG - Intergenic
989330603 5:40253585-40253607 GCAACAGTAAACAAAAAGCATGG - Intergenic
990202636 5:53395605-53395627 ACTCTAGTAACCAAAGAGCATGG - Intergenic
990936442 5:61155443-61155465 GCTACAGTAACCAAAACGCATGG - Intergenic
991158260 5:63463962-63463984 GCTACAGTAACCAAAAAACATGG + Intergenic
991175089 5:63678358-63678380 GCTACAGTAACCAAACAGCACGG - Intergenic
991186928 5:63819348-63819370 GCTACAGTAAGCCATGATCGTGG + Intergenic
991302340 5:65141139-65141161 GCTACAGTAACCAAACAGCATGG - Intergenic
991324724 5:65417984-65418006 GCTACAGTAACCAAACAGTATGG + Intronic
991353214 5:65740786-65740808 GCTATAGTAACCAAACAGCATGG - Intronic
992355757 5:75981477-75981499 GCTACAGTAAACAAACAACATGG + Intergenic
992453765 5:76897036-76897058 GCTATAGTAACCAAACAGCATGG - Intronic
992604003 5:78436604-78436626 GCTACAGTAACCAAACAGCATGG - Intronic
992674999 5:79097275-79097297 GCTACAGTAACCAAACAGCATGG - Intronic
992725156 5:79599119-79599141 GCTATAGTAACCAAACAGCATGG - Intergenic
992829645 5:80581867-80581889 GCTACAGTAACCAAAACACATGG - Intergenic
993420282 5:87693079-87693101 GCTACAGTAATAAAACAGCATGG - Intergenic
993794813 5:92253857-92253879 GCTACAGTAATCAAAATACATGG + Intergenic
993808326 5:92440575-92440597 GCTACAGTAACCAAACAGTATGG + Intergenic
993952862 5:94197851-94197873 GCTATGGTAACCAAACAGCATGG - Intronic
993956831 5:94244392-94244414 GCTACAGTGAGCTATGATCATGG - Intronic
994348400 5:98715858-98715880 GCTACAGTAACCAAACAGCATGG - Intergenic
994479042 5:100309902-100309924 GCTAGAGTAACCAAACAGCATGG + Intergenic
994574822 5:101564890-101564912 GCTACAATAACAAAACAGCATGG - Intergenic
994636423 5:102350109-102350131 GCTATAGTTACCAAATAGCATGG + Intergenic
994644948 5:102456862-102456884 GCTACAGTACCAAAACAGCATGG + Intronic
995401500 5:111747459-111747481 GCTCCAGTAATCAAAGGACATGG + Intronic
995572739 5:113497832-113497854 GCTGTAGTAACCAAATAGCATGG - Intergenic
995991534 5:118245914-118245936 GCTTCAGTAGGCAAGGAGAAGGG - Intergenic
996169835 5:120275833-120275855 GCTACAGTAACCAAAACGCATGG + Intergenic
996335403 5:122378920-122378942 GCTACAGTACCAAAACAGCATGG - Intronic
996399722 5:123048571-123048593 AATACAGTAATCAAACAGCATGG - Intergenic
996458120 5:123708372-123708394 CCTACCCAAAGCAAAGAGCAGGG - Intergenic
996608666 5:125353402-125353424 GCTATAGTTACCAAACAGCATGG - Intergenic
996633263 5:125662807-125662829 ACTACAGTAACCAAATGGCATGG - Intergenic
997136625 5:131333348-131333370 GCTACAGTAACCAAACAGCATGG - Intronic
998541542 5:142986885-142986907 GCTACAGTAACCAAACAGCATGG - Intronic
999064336 5:148669577-148669599 GCTACAGTAACAAAACAGCATGG - Intronic
999175852 5:149631231-149631253 GCTGCAGTAAGCCGAGATCATGG - Intronic
999369289 5:151043711-151043733 GCTGCAGTAAGCCGAGATCATGG + Intronic
999508697 5:152225264-152225286 GCTAAAGGAAGAAAAGAGAAAGG + Intergenic
999807362 5:155095021-155095043 GCTACAGTAGGCAATGATGATGG + Intergenic
1000408404 5:160913202-160913224 GCTGCAGAAAGCACAGAGCTGGG - Intergenic
1000555642 5:162722380-162722402 CCTCCAGTAAGCATACAGCATGG + Intergenic
1000572524 5:162932917-162932939 GTTCCAGTAACCAAAAAGCATGG - Intergenic
1002700986 5:181124690-181124712 GACACAGCAAGCAAAGAGGAGGG + Exonic
1003700342 6:8457557-8457579 GCTACAGTAACCAAACGGCATGG - Intergenic
1003855113 6:10265625-10265647 GCTACAGTAACCAAACAGCATGG - Intergenic
1004056486 6:12144140-12144162 GCTACAGTAACCAAACAGCATGG + Intronic
1004834230 6:19512977-19512999 GCTACAGTAACCAAACAGCATGG - Intergenic
1005620005 6:27611340-27611362 TCTACAGAAAGCAGAGAGCTAGG + Intergenic
1006171016 6:32092771-32092793 GCTACAGACAGCAGAAAGCATGG + Intronic
1006579250 6:35067199-35067221 GGGACAGAAAGCAAAGAGGAGGG - Intronic
1007314878 6:40979250-40979272 GCTACAGTAGGGGAAGAGCAGGG + Intergenic
1007858567 6:44883629-44883651 GCTACAGTAACCAAAAAGCATGG + Intronic
1008064933 6:47037567-47037589 GCTACAGTGAGCTATGATCATGG - Intronic
1008517345 6:52330556-52330578 GCCAGAGTCAGAAAAGAGCATGG + Intergenic
1008737530 6:54564037-54564059 GCTACAGTAATAAAACAGCATGG + Intergenic
1008855152 6:56075662-56075684 ACTACAGTAAGGAAGGAGCAAGG + Intronic
1009278262 6:61713653-61713675 CATATAGTAAGCAAACAGCATGG + Intronic
1009429765 6:63552902-63552924 GCTACAGTACCAAAACAGCACGG - Intronic
1009646500 6:66409776-66409798 GCTACAGTAACTAAAAAGCATGG + Intergenic
1009764728 6:68057385-68057407 GCTACAGTACCAAAACAGCATGG - Intergenic
1009999103 6:70929952-70929974 GCTACAGTAACCAAATAGCATGG + Intronic
1010038707 6:71356715-71356737 GCTACAGTAACCAAACAGCATGG - Intergenic
1010322739 6:74531659-74531681 GCTACAGTAACAAAATAGCATGG + Intergenic
1010493614 6:76504616-76504638 GCTACAGTAACCAAAAAGCATGG - Intergenic
1010545883 6:77155343-77155365 GCTATAGTAACAAAACAGCATGG - Intergenic
1010629767 6:78184711-78184733 GCTATAGTAACCAAAACGCATGG - Intergenic
1010948641 6:82008353-82008375 GCTACGGTAACCAAGCAGCATGG + Intergenic
1010976290 6:82317872-82317894 GCTATAGTCACCAAACAGCATGG + Intergenic
1011365676 6:86579247-86579269 GCTACAGTCACCCAACAGCATGG - Intergenic
1011373087 6:86660981-86661003 GCCACAGTAACCAAACAGCATGG - Intergenic
1011630859 6:89322718-89322740 GCTATAGTTACCAAAAAGCATGG + Intergenic
1011731419 6:90268068-90268090 GTTGCAGTAAGCCAAGATCATGG - Intronic
1012538279 6:100326570-100326592 GCAACAGATAGCAAAGAGGAAGG - Intergenic
1012596702 6:101049548-101049570 GCTACAGTGACCAAACAGCATGG - Intergenic
1012688221 6:102278921-102278943 GCTACAGTAACAAAACAGCTTGG - Intergenic
1012698709 6:102423683-102423705 GCAATAGTAACCAAACAGCATGG + Intergenic
1012949387 6:105502055-105502077 GGTACACTTGGCAAAGAGCAGGG - Intergenic
1013433020 6:110072616-110072638 GCTGCAGTAACCAAAAAGCATGG + Intergenic
1013847692 6:114473892-114473914 GCTACAGTCAGCAAAGAAACAGG + Intergenic
1014081907 6:117296981-117297003 GCTATAGTAATCAAACAGTATGG + Intronic
1014185071 6:118425788-118425810 GCTACAGTAACAAAACAGCATGG + Intergenic
1014279270 6:119422696-119422718 GCTACAGTAACAAAACAGCATGG + Intergenic
1014709691 6:124792233-124792255 GAAACAGTAAGGAAAGAGGAAGG + Intronic
1014907828 6:127051396-127051418 CCTACAGTAGCCAAACAGCATGG + Intergenic
1015197821 6:130543347-130543369 GCTACAGTAACCAAACAGCATGG + Intergenic
1015241591 6:131030084-131030106 GTTGCTGTAAGCATAGAGCACGG - Intronic
1015655240 6:135510818-135510840 GCTACAGTAACCAAACAGCATGG - Intergenic
1015691353 6:135927266-135927288 GCTACAGTAACCAATCAACATGG - Intronic
1015767523 6:136734356-136734378 GTTACAGTGAGCAGAGATCATGG + Intronic
1016079962 6:139843881-139843903 GCTACAGTAACAAAACAGCGTGG + Intergenic
1016425208 6:143928492-143928514 TCTATAGTAATCAAACAGCATGG - Intronic
1016568660 6:145488198-145488220 GCTACAGTAACCAAACAGCATGG - Intergenic
1016730872 6:147426302-147426324 GCTACAGTAACAAAACAGCATGG - Intergenic
1016991055 6:149928619-149928641 GCTACAGTAACCAAACAGCATGG - Intergenic
1017285875 6:152675827-152675849 GCTACAGTAACAAAACAGCACGG + Intergenic
1017369652 6:153690189-153690211 GTTACAGAAGGCAAAGTGCATGG + Intergenic
1017930612 6:158951154-158951176 GCTACAGTAAAAAAACAGCTTGG + Intergenic
1018049203 6:159993600-159993622 GCTATAGTAATCAAACAGCATGG - Intronic
1018304195 6:162437504-162437526 GTTACAGTCAGCACAGAGGACGG + Intronic
1019511825 7:1421590-1421612 GCCAGAGTAAGCAAACGGCAGGG + Intergenic
1020262497 7:6538302-6538324 GCTGCAGTGAGCCAAGATCATGG + Intronic
1020262523 7:6538503-6538525 GCTGCAGTGAGCCAAGATCATGG + Intronic
1020272125 7:6603186-6603208 GTTTCAGTGAGCCAAGAGCATGG + Intronic
1020394711 7:7700986-7701008 GCTACAGTGAGCTATGATCACGG + Intronic
1020652517 7:10892744-10892766 GAGACAGTGAGAAAAGAGCAAGG - Intergenic
1020754451 7:12183989-12184011 GCTACAGTAACAAAACAGCATGG + Intergenic
1021273713 7:18623875-18623897 GTTACAGTGAGCCAAGATCACGG + Intronic
1022662895 7:32382849-32382871 GCGACAGTGAGCAAGGAGTAGGG - Intergenic
1023084839 7:36560113-36560135 GCTACAGTGACCAAAACGCATGG - Intronic
1023571699 7:41579051-41579073 TCTACAATAATCAAAAAGCAGGG + Intergenic
1023890064 7:44385663-44385685 ACAACAGCAAGCAGAGAGCAGGG + Exonic
1024738530 7:52331497-52331519 GCTACAGTAACCAAAAAGCACGG + Intergenic
1025577932 7:62671604-62671626 GCTGCAGTAACCAAACAGCATGG + Intergenic
1025806208 7:64836747-64836769 CATACAGGAAGCAAAGTGCAGGG + Intergenic
1025912835 7:65841460-65841482 GCTACAGTGAGGCAAGAGCTGGG - Intergenic
1026205104 7:68250428-68250450 CCTACGGTATGCATAGAGCAAGG + Intergenic
1026365828 7:69647410-69647432 GCTACAGTGAGCAATGCTCATGG - Intronic
1026438332 7:70419512-70419534 GCTACTGTCAGCACATAGCAAGG - Intronic
1027694167 7:81388093-81388115 CCTACAGTCAGGAAAGTGCAAGG - Intergenic
1027886245 7:83909567-83909589 GCTACAGTAAGCCAAGATTGCGG - Intergenic
1027912105 7:84263699-84263721 GATACAGGAAGTAACGAGCATGG - Intronic
1027964545 7:84988819-84988841 GCTACAGTAACAAAACAGCATGG - Intergenic
1028003923 7:85538522-85538544 GCTACAGTACCAAAACAGCATGG - Intergenic
1028028029 7:85871202-85871224 GCTACAGTAACCAAACAGCACGG + Intergenic
1028181623 7:87731038-87731060 GCTACAGTGACCAAAGACTAAGG + Intronic
1028236750 7:88372169-88372191 GCTACGGTAACCAAACAGCATGG - Intergenic
1028346893 7:89794000-89794022 GCTACAGTAACCAAAATGCATGG - Intergenic
1028777262 7:94692342-94692364 GCTATAGTAACCAAACATCATGG - Intergenic
1030342339 7:108394257-108394279 GCTTCAGTCAGGAAAGGGCAGGG + Intronic
1030505610 7:110418121-110418143 GCTGCAGTGAGCAAAGTGGAGGG - Intergenic
1030507861 7:110446810-110446832 ACAACAGTAAGTAAAAAGCAAGG - Intergenic
1030508941 7:110458937-110458959 GCTACAGTAACCAAACAGCATGG + Intergenic
1030838189 7:114314402-114314424 TCTGAAGGAAGCAAAGAGCAAGG - Intronic
1030863432 7:114667365-114667387 GTTACAGTAAGCTATGATCATGG + Intronic
1031211486 7:118834177-118834199 GCTACAGTAATCAGACATCATGG + Intergenic
1031260212 7:119508085-119508107 GCTACAGTGACCAAAGACTAAGG + Intergenic
1031771039 7:125844130-125844152 ACTACAGAAAGAAGAGAGCATGG + Intergenic
1031802273 7:126262620-126262642 GCTATAGTAAGCAAACAGCATGG - Intergenic
1031831437 7:126631644-126631666 GCTACAGTAACCAGATAGCACGG + Intronic
1031999814 7:128257624-128257646 GCGACAGGAAACAAAGAGCAGGG - Exonic
1032892909 7:136218888-136218910 GGTACAGAAAGCAAATTGCAGGG + Intergenic
1032942766 7:136814068-136814090 GACACAGTAACCAAACAGCATGG - Intergenic
1032956690 7:136979826-136979848 GCCACAGTAGCCAAACAGCATGG - Intronic
1033676896 7:143550697-143550719 GTTATAGTAACCAAAAAGCATGG - Intergenic
1033694939 7:143778738-143778760 GTTATAGTAACCAAAAAGCATGG + Intergenic
1035646859 8:1230618-1230640 CCTACAGTAACCAAATAGCATGG + Intergenic
1035696081 8:1597245-1597267 GCCACAGTAACCAAACAGGATGG - Intronic
1036275184 8:7345014-7345036 GCTACGGTAACCCAACAGCATGG + Intergenic
1036346177 8:7965335-7965357 GCTACAGTAACCCAACAGCATGG - Intergenic
1036576660 8:10033629-10033651 GCTATAGCAACCTAAGAGCATGG + Intergenic
1036841496 8:12126091-12126113 GCTACAGTAACCCAACAGCATGG - Intergenic
1036863309 8:12372340-12372362 GCTACAGTAACCCAACAGCATGG - Intergenic
1037000345 8:13709596-13709618 GCTATAGTAACCAAACAGCATGG - Intergenic
1037658784 8:20909591-20909613 GCTAGAATAAGGATAGAGCAAGG + Intergenic
1037706922 8:21323127-21323149 GCAACAGGAGGCAAAGAGGATGG - Intergenic
1037798956 8:22021004-22021026 GCTATAGTAACAAAACAGCATGG + Intergenic
1039036465 8:33365019-33365041 GCTATAGTAACCAAACAGCATGG + Intergenic
1040075703 8:43227171-43227193 GCTATAGCAACCAAACAGCATGG - Intergenic
1040481245 8:47830037-47830059 GCTGCAGTAACCAAAAAGCATGG + Intronic
1041222387 8:55664896-55664918 GCTACAGTAACCAAAACGCATGG - Intergenic
1041337014 8:56797095-56797117 GCTTGAGGAAGCAAAGAACAGGG - Intergenic
1041439369 8:57877518-57877540 ACTACAGAAAAGAAAGAGCATGG - Intergenic
1041484956 8:58365389-58365411 GCTATAGTAACAAAACAGCATGG + Intergenic
1041760086 8:61356795-61356817 GCTACAGTAACAAAACAGCATGG - Intronic
1042330819 8:67578855-67578877 CAAACAGTAATCAAAGAGCAAGG - Intronic
1042362544 8:67899011-67899033 GCTACAGTAACAAAACAGCATGG + Intergenic
1042780548 8:72486256-72486278 GCTACAGCAACAAAACAGCATGG + Intergenic
1043214073 8:77563354-77563376 GCTGCAGTAACAAAACAGCATGG + Intergenic
1043269079 8:78306252-78306274 TCTATAGTAACCAAACAGCATGG - Intergenic
1043382015 8:79712800-79712822 GCTACAGTAACCAGACAGCATGG + Intergenic
1043594687 8:81870780-81870802 GCTACAGTAACTCAAGAGCCTGG + Intergenic
1043640761 8:82447572-82447594 GCTACAGTAGCCAAACAGCATGG - Intergenic
1043689276 8:83130410-83130432 GCTAAAGTAAGCAGATAGCTAGG + Intergenic
1043774127 8:84243199-84243221 GCTACAGTAACCAAACAGCATGG - Intronic
1043819592 8:84846017-84846039 GCTACGGTAACCAAAAAGCATGG - Intronic
1044086532 8:87949243-87949265 GCCACAGTAACCAAACAGTATGG + Intergenic
1044185603 8:89247261-89247283 GCTCTAGTAATCAAACAGCATGG - Intergenic
1044351392 8:91170512-91170534 GCTACAGTAACCAAACAGCATGG + Intronic
1044380980 8:91533279-91533301 GCTTCATTAGGCAAAAAGCATGG - Intergenic
1045004871 8:97908998-97909020 GCTGAAGTAAGCCAAGATCAGGG - Intronic
1045151353 8:99411930-99411952 GCTACAGTAACCAAACAGCATGG - Intronic
1045592113 8:103609714-103609736 GCTACCATAATCAAACAGCATGG - Intronic
1045592796 8:103617128-103617150 GCTACAGTAACCAACCAGCATGG + Intronic
1045593940 8:103631511-103631533 GCTACAGTGACCAAACAGCTCGG - Intronic
1046372823 8:113332886-113332908 GCTACAGTAATTACATAGCATGG + Intronic
1046429785 8:114109468-114109490 GCTACAGTAACAAAACAGTATGG + Intergenic
1046688474 8:117255001-117255023 GCTACAGTAACCAACCATCATGG + Intergenic
1047102444 8:121692888-121692910 GCTAAAGTAACAAAAAAGCATGG + Intergenic
1047158196 8:122345835-122345857 GCTACAGTAATCAAACAGCCTGG + Intergenic
1047231194 8:122999783-122999805 GCTACAGTACCAAAACAGCATGG - Intergenic
1047357202 8:124134079-124134101 CCTACAGTAACCAAACAGCATGG + Intergenic
1047551950 8:125883699-125883721 GTAACAATAACCAAAGAGCAAGG + Intergenic
1047575820 8:126154152-126154174 GCTACAGTAACTAAACAGTATGG + Intergenic
1048301380 8:133253758-133253780 GCTACAGTGAGCAGTGAGCTGGG - Intronic
1048435085 8:134408656-134408678 GCTGCAGTAAGCCATGAGCCAGG + Intergenic
1048505895 8:135021232-135021254 GCTGAAATAAGCAAAGAGGAAGG - Intergenic
1049328590 8:142037871-142037893 GCTACAGTAAGGACAGAGGGAGG - Intergenic
1050390417 9:5137380-5137402 GCTATAGTAACAAAACAGCATGG + Intronic
1050427611 9:5527888-5527910 GTTGCAGTAAGCCAAGATCACGG - Intronic
1050864673 9:10483046-10483068 GCTATAGTAACCAAACAGCATGG + Intronic
1051015181 9:12465929-12465951 GCTTCAGTAAGAAAGAAGCATGG - Intergenic
1051045325 9:12866194-12866216 GCTGCAGTAACCATACAGCATGG - Intergenic
1051093133 9:13433560-13433582 GTTACAGTGAGCCAAGATCATGG + Intergenic
1052147208 9:25064137-25064159 GCTACAGTAACCAAACAGCATGG - Intergenic
1052242338 9:26289313-26289335 GCTACAGTAAACAAACAGGATGG - Intergenic
1052258934 9:26492017-26492039 GCTGCAGCAAGCCAAGACCACGG - Intergenic
1052329845 9:27256322-27256344 GCTACAGTAACAAAACAGCATGG + Intergenic
1052364238 9:27594005-27594027 GCTACAGTAACCAAGCAGCATGG + Intergenic
1052597915 9:30585300-30585322 GCTACAGTAACAAAACAGTATGG + Intergenic
1052623962 9:30950912-30950934 ACTACAGTAAGCAAAGAAAATGG + Intergenic
1052702558 9:31955560-31955582 GCTATAGTATTCAAAGAGTATGG + Intergenic
1053369239 9:37546740-37546762 GCTGCAGTGAGCAAAGATCATGG - Intronic
1053751350 9:41259490-41259512 GCTACAGTAACCAAACAGCATGG - Intergenic
1054256872 9:62823819-62823841 GCTACAGTAACCAAACAGCATGG - Intergenic
1054334434 9:63791794-63791816 GCTACAGTAACCAAACAGCATGG + Intergenic
1054932321 9:70648412-70648434 GCTGCAGTAAGCCATGATCATGG + Intronic
1054971466 9:71092856-71092878 GCTACAGTAACCAAACAGCATGG + Intronic
1055278776 9:74650094-74650116 TCTACAGTAAGCAAAAGGAAAGG + Intronic
1055340328 9:75274655-75274677 GCTATAGTAACCAAACAGCATGG - Intergenic
1055494646 9:76842102-76842124 GCTACAGTAACCAAACAGCCTGG + Intronic
1055992658 9:82124045-82124067 GCTGCAGTGAGCCAAGATCACGG + Intergenic
1056012712 9:82348998-82349020 GCTACAATAACCAAACAGCATGG - Intergenic
1056148677 9:83762659-83762681 GCTATAGTAACCAAATAACAAGG + Intronic
1056211712 9:84371031-84371053 GCTACAGTAACCAAATAGCATGG - Intergenic
1056877824 9:90351993-90352015 GCTGCAATAACCAAACAGCATGG + Intergenic
1056948491 9:91022401-91022423 GCCACAGTCACCAAACAGCATGG + Intergenic
1057120577 9:92569461-92569483 GCTACAGTAACCAAACAGCATGG - Intronic
1057135690 9:92686294-92686316 GCTGCAGTGAGCCAAGATCACGG - Intergenic
1057493401 9:95540684-95540706 GCTACAGTGAGCCATGATCATGG - Intergenic
1057763785 9:97898391-97898413 GCTACAGTGAGCCGAGATCATGG - Intergenic
1058091717 9:100813495-100813517 GCTCCAGGAAGCAAAGAGGCAGG - Intergenic
1058138448 9:101333716-101333738 GCTACAGTAAGCCATGATCCTGG + Intergenic
1058199656 9:102023619-102023641 GCTACGTTAACCAAACAGCATGG - Intergenic
1059180152 9:112204350-112204372 GCTACAGTAACCAAAAAGTATGG - Intergenic
1059596704 9:115728566-115728588 GCTACCATAACCAAACAGCATGG + Intergenic
1060060625 9:120456223-120456245 GTGGCAGTCAGCAAAGAGCAGGG + Intronic
1060390446 9:123272192-123272214 GTTACAGTGAGCCAAGATCATGG + Intergenic
1060774206 9:126358196-126358218 GCTACAGTAATCAAAGAGTATGG - Intronic
1061269798 9:129532786-129532808 GCTACAGTAAGCAGACAGTGTGG + Intergenic
1061951046 9:133935943-133935965 GCTCCAGGAGGCAAAGGGCATGG + Intronic
1187143345 X:16615275-16615297 GCTGCAGTAAGCCATGATCATGG + Intronic
1187156354 X:16723745-16723767 GTTAAAGTAAACACAGAGCAAGG - Intronic
1187840734 X:23484758-23484780 GCTACAGGAACAAAACAGCATGG + Intergenic
1187997599 X:24945426-24945448 GTTACAGTATGAAAAAAGCATGG + Intronic
1188139353 X:26529311-26529333 GCTACAGTAATCAAATAGTATGG + Intergenic
1188848927 X:35108511-35108533 GCTACAGTAACAAAACAACATGG + Intergenic
1189154469 X:38743004-38743026 GCTACAGTAACAAAAAAGCATGG - Intergenic
1189594971 X:42554484-42554506 ACTACAGTAACCAAACAGCATGG - Intergenic
1191032104 X:55985506-55985528 GCTGCAGTAACCAAACAGCATGG - Intergenic
1191568414 X:62571663-62571685 GCTACAGTAACCAAACAGCATGG - Intergenic
1191708380 X:64118295-64118317 GATACAGTAACCAAAGCGCATGG - Intergenic
1191824590 X:65351082-65351104 GCTACTGTAACCAAATAGCATGG + Intergenic
1191959256 X:66681826-66681848 GCTACAGTAATCTAACAGCATGG - Intergenic
1192702467 X:73489911-73489933 GCTACAGTATCAAAACAGCATGG - Intergenic
1193013442 X:76705081-76705103 ACAATAGTAAGCAAATAGCATGG + Intergenic
1193634815 X:83936218-83936240 GCTGCAGTAACCAAACAGCATGG - Intergenic
1193970443 X:88044534-88044556 GCTATAGTAACCAAACAGTATGG + Intergenic
1193991459 X:88313097-88313119 GCTACAGTAACCAAACGGCATGG + Intergenic
1194273826 X:91855378-91855400 GCTATAGTAACCAAATAGCATGG - Intronic
1194545552 X:95229450-95229472 GCTACAGTAACCAAAAAGCATGG + Intergenic
1194587724 X:95756701-95756723 GCCACAGTAACCAAACAGCATGG - Intergenic
1194617621 X:96126074-96126096 TCCACAGTAAGAAAAGGGCAGGG - Intergenic
1195103252 X:101576631-101576653 GCTACAGTAAGCAAACAGCATGG - Intergenic
1195350429 X:103990721-103990743 GCTATGGTAACCAAACAGCATGG + Intergenic
1195582439 X:106522752-106522774 GCTCTAGTAATCAAACAGCATGG - Intergenic
1195654644 X:107323466-107323488 CCTACAGTTGTCAAAGAGCACGG - Intergenic
1195660343 X:107371779-107371801 GCTACAGAAATCAAAGGGGAAGG + Intergenic
1195834126 X:109093276-109093298 GCTACAGTAACCAAAACGCATGG - Intergenic
1195872097 X:109497300-109497322 GTTATAGTAACCAAATAGCATGG - Intergenic
1196172647 X:112606984-112607006 GCTACAGTAACCAAACAGCATGG + Intergenic
1196352527 X:114748518-114748540 GCTACAGTAATCAAGAAGAATGG + Intronic
1196672564 X:118384558-118384580 GCTACAGTTACCAAACAGCATGG - Intronic
1197023913 X:121723929-121723951 GCTACAGTAACCAAGCAGCATGG + Intergenic
1197101187 X:122657287-122657309 GCTATAGTAAACAAACAGCATGG + Intergenic
1197396766 X:125937126-125937148 GCTACAGTAACAAAATAGCATGG - Intergenic
1198702184 X:139408909-139408931 GCTATAGTAACTAAATAGCATGG - Intergenic
1198810823 X:140534500-140534522 GTTCCTATAAGCAAAGAGCATGG - Intergenic
1198960657 X:142179116-142179138 GCTACAGTAACCAAACAGCATGG - Intergenic
1199000363 X:142629210-142629232 GCTACAGTAACCAAACAGCATGG - Intergenic
1199114281 X:143971729-143971751 GCTATAGGAACCAAACAGCATGG - Intergenic
1199163542 X:144643619-144643641 GCTACAGTAACCAAACAGCATGG + Intergenic
1199404954 X:147445809-147445831 GCTACAATAACCAAACAGCATGG - Intergenic
1199456757 X:148037755-148037777 GCTACAGTGAGCCATGATCATGG + Intergenic
1199805179 X:151292553-151292575 GCTATGGTAACCAAATAGCATGG - Intergenic
1199891019 X:152082094-152082116 GCTACAGTAATCAAAACACATGG + Intergenic
1200272791 X:154702121-154702143 GCTATGGTAACCAAACAGCATGG + Intronic
1200358747 X:155579361-155579383 GCTATAGGAACCAAACAGCATGG + Intronic
1200591064 Y:5076795-5076817 GCTATAGTAACCAAATAGCATGG - Intronic
1200889402 Y:8307073-8307095 GCTACAGTAACCAAACAGCATGG - Intergenic
1201011779 Y:9554287-9554309 GCTACAGTGGGCAGAGATCATGG - Intergenic
1201303562 Y:12531437-12531459 TCTACTGTAAGCAAATACCAGGG - Intergenic
1201770466 Y:17613113-17613135 CATACAGGAAGCAAAGTGCAGGG - Intergenic
1201831088 Y:18292874-18292896 CATACAGGAAGCAAAGTGCAGGG + Intergenic
1201902782 Y:19060326-19060348 GTTGCAGTAAGCCAAGACCACGG + Intergenic
1201946728 Y:19518635-19518657 GCTACAGTAACCAAACAGCGTGG + Intergenic
1201958675 Y:19653849-19653871 GCTATAGTAATCAAACAGCGTGG - Intergenic
1201969194 Y:19773039-19773061 GCCAAAATAAGCAAAGAGCTGGG + Intergenic
1202063764 Y:20915690-20915712 GCTACAGTAACCAAACAGCATGG - Intergenic
1202361094 Y:24111069-24111091 GCTACAACAACCAAACAGCATGG - Intergenic
1202509684 Y:25559049-25559071 GCTACAACAACCAAACAGCATGG + Intergenic