ID: 1066174575

View in Genome Browser
Species Human (GRCh38)
Location 10:32890650-32890672
Sequence CTGTGTCCTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066174570_1066174575 -8 Left 1066174570 10:32890635-32890657 CCCTCTGTTTCCTTGCTGTGTCC No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data
1066174571_1066174575 -9 Left 1066174571 10:32890636-32890658 CCTCTGTTTCCTTGCTGTGTCCT No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data
1066174568_1066174575 19 Left 1066174568 10:32890608-32890630 CCATTTCCAGGTTCACAGACGCT No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data
1066174566_1066174575 27 Left 1066174566 10:32890600-32890622 CCGAGGACCCATTTCCAGGTTCA No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data
1066174567_1066174575 20 Left 1066174567 10:32890607-32890629 CCCATTTCCAGGTTCACAGACGC No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data
1066174569_1066174575 13 Left 1066174569 10:32890614-32890636 CCAGGTTCACAGACGCTGTGACC No data
Right 1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066174575 Original CRISPR CTGTGTCCTCAGATGGTGGA AGG Intergenic
No off target data available for this crispr