ID: 1066180285

View in Genome Browser
Species Human (GRCh38)
Location 10:32955816-32955838
Sequence TCAGCAATTCTGAAAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066180285_1066180288 9 Left 1066180285 10:32955816-32955838 CCAGTGACTTTCAGAATTGCTGA 0: 1
1: 0
2: 3
3: 24
4: 206
Right 1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG No data
1066180285_1066180287 8 Left 1066180285 10:32955816-32955838 CCAGTGACTTTCAGAATTGCTGA 0: 1
1: 0
2: 3
3: 24
4: 206
Right 1066180287 10:32955847-32955869 TTCTCATGTGCAGAATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066180285 Original CRISPR TCAGCAATTCTGAAAGTCAC TGG (reversed) Intronic
901378839 1:8859316-8859338 TAAGCACGTCTGAAATTCACAGG - Intergenic
902730651 1:18366591-18366613 TCGAGAATTCTGAAAGTCATAGG + Intronic
903700304 1:25242115-25242137 TCAGCATTTCTCAAAATCTCAGG + Intergenic
903876382 1:26476911-26476933 TCAGCAATAATGAAAGTAAATGG - Intergenic
904547339 1:31285774-31285796 TCAACACTTCTGAAAGTTACAGG + Intronic
904875276 1:33650040-33650062 TCTGCTCTTTTGAAAGTCACCGG + Intronic
905770519 1:40635254-40635276 TTAAAAAATCTGAAAGTCACTGG - Intronic
906687289 1:47770848-47770870 CCAGAGACTCTGAAAGTCACAGG + Intronic
910970781 1:92853634-92853656 TGAGCACTTTTTAAAGTCACAGG - Intronic
911596932 1:99808591-99808613 TCAAAAACTCTGAAAGTCACTGG + Intergenic
914880552 1:151543172-151543194 TCTGCAGTTCTGAAAAACACTGG - Intronic
915476177 1:156154088-156154110 TCAACAGATCTGAAAGTGACAGG + Intronic
917168182 1:172137522-172137544 TCAGAAAATTTGAAACTCACTGG + Intronic
918557272 1:185817593-185817615 TTCTAAATTCTGAAAGTCACTGG + Intronic
919022100 1:192119351-192119373 ACATCAATTCTGAAATTCAGAGG + Intergenic
919366017 1:196661946-196661968 TAAGCAAGTCTGAAATCCACAGG + Intronic
920042851 1:203114425-203114447 TCAGCAGATCTGTCAGTCACAGG - Intronic
920449569 1:206049044-206049066 TCAGCAATTCTCAAACTCTTTGG + Intronic
921858238 1:220012627-220012649 TATGCAATTCTAAAAGTCTCTGG + Intronic
923164991 1:231352114-231352136 TCAGTAACTCTGAACTTCACAGG - Intronic
923447229 1:234083206-234083228 GCAGCAATTCTGCTAATCACTGG - Intronic
924071066 1:240279351-240279373 GCAGAAATGCTGAAAGTCACTGG + Intronic
924735770 1:246754264-246754286 TCAGCAATGCAGAAAGAAACTGG - Intronic
1063016313 10:2081148-2081170 TTAGTAATTCTGAAATCCACAGG - Intergenic
1065871230 10:29957998-29958020 TCAGCCACTCTGAAAGCCGCAGG + Intergenic
1065982546 10:30914651-30914673 ACAGCATTTCTCAAAGACACTGG + Intronic
1066180285 10:32955816-32955838 TCAGCAATTCTGAAAGTCACTGG - Intronic
1068248548 10:54406186-54406208 TCACGAATACTGAAATTCACAGG - Intronic
1068883446 10:62074703-62074725 TACGCAATTCAGAAAGTCACAGG + Intronic
1072392140 10:94998052-94998074 TCAGCAATGCGGAAAGAAACCGG - Intergenic
1072767637 10:98108574-98108596 TGAGCAGATCTGAAAGCCACAGG + Intergenic
1074503995 10:114051106-114051128 TGAGCAATACTGAAATTCTCAGG - Intergenic
1074637150 10:115332766-115332788 TCAGAAAATCTGAAAGTGAGAGG - Intronic
1074677349 10:115866968-115866990 TGAGCAAGCCTGAAATTCACAGG - Intronic
1074775322 10:116763840-116763862 TCATAAATTATGAAAGCCACTGG + Intergenic
1075788093 10:125063821-125063843 ACAGCGATTCTCAAAGCCACAGG + Intronic
1076764442 10:132625328-132625350 ACAGTAATTCAGAAAGACACAGG - Intronic
1078049480 11:7949567-7949589 CCAGCAACACTGATAGTCACAGG - Intergenic
1079520517 11:21321123-21321145 TCTGCAACTCTGAAATTCCCTGG + Intronic
1083072132 11:59995515-59995537 TCAGCAAATCTAAAAGTTTCTGG + Intergenic
1084974796 11:72790847-72790869 CCTGCATTTCTGAAAGTCAAGGG - Intronic
1086641347 11:89160512-89160534 GCAGAAATTCTGAAAGGCTCAGG - Intergenic
1087459917 11:98433046-98433068 TCAGCAAAGCTGAATGTCTCAGG - Intergenic
1090077199 11:123586994-123587016 TCAGCGATTCTGCAGGGCACTGG - Intronic
1092504327 12:9080351-9080373 GAAGAAATTCTGAAAATCACAGG - Intronic
1092595162 12:9995128-9995150 TCAGAAAATATGTAAGTCACTGG - Exonic
1092801242 12:12169367-12169389 TCTGCAATTCTGAAATCCAAAGG - Intronic
1092914337 12:13176201-13176223 TGAGAAATTCTTGAAGTCACAGG - Intergenic
1094628205 12:32146564-32146586 TAAGTAGTTCTTAAAGTCACAGG + Intronic
1099883409 12:88497540-88497562 TCAGGAGGTATGAAAGTCACAGG - Intronic
1099889780 12:88577346-88577368 TCAGTATTTCTGAAATTGACAGG + Intronic
1101809379 12:108094333-108094355 ACATCAATTCTAAAAGTCACTGG - Intergenic
1105551348 13:21398865-21398887 ACAGCAATTGTGAATGCCACAGG + Intronic
1106881091 13:34131261-34131283 TCAACAATACCCAAAGTCACGGG - Intergenic
1107167789 13:37302807-37302829 TCAAGAGTTGTGAAAGTCACTGG - Intergenic
1108008576 13:45978763-45978785 TCACCAGTTCTAAAAGTCCCAGG + Intronic
1108816650 13:54300683-54300705 AGAGCAAATGTGAAAGTCACTGG - Intergenic
1110283148 13:73719110-73719132 TCAGCAGTTCTGAAAGGCATAGG - Intronic
1113310214 13:109124210-109124232 TCAGCAACCAAGAAAGTCACAGG - Intronic
1114642429 14:24232510-24232532 TCTGCGATTCTGAGAGTCCCTGG + Intronic
1114830821 14:26139735-26139757 TAAGAAAATGTGAAAGTCACAGG + Intergenic
1114870563 14:26650851-26650873 CTAGCAAGTCTGAAATTCACAGG - Intergenic
1115124000 14:29971272-29971294 TCTGCAGTTCTGCCAGTCACCGG + Intronic
1116220216 14:42075529-42075551 TTAGAAATTCTGAAATTCAGGGG + Intergenic
1118406757 14:65432033-65432055 TTGGCAATTCAGAAGGTCACTGG - Intronic
1120536689 14:85705150-85705172 TGAGCCACTTTGAAAGTCACTGG - Intergenic
1121386910 14:93536301-93536323 TTAGAAATTCTGAAAGTCACAGG + Intronic
1122831118 14:104396382-104396404 GCAGCAATTCTGAAAAGCAGCGG - Intergenic
1123144492 14:106115743-106115765 CCAGCTCTTCTCAAAGTCACAGG + Intergenic
1123156698 14:106234158-106234180 TCAGCTCTCCTCAAAGTCACGGG + Intergenic
1123457182 15:20436874-20436896 TTAGCCATCCTGAATGTCACAGG + Intergenic
1123660876 15:22563485-22563507 TTAGCCATCCTGAATGTCACAGG - Intergenic
1123979159 15:25583451-25583473 GAAGCAACTGTGAAAGTCACAGG + Intergenic
1124187853 15:27545464-27545486 TCATCAAATCTGAGAGTCGCAGG + Intergenic
1124263338 15:28212023-28212045 TTAGCCATCCTGAATGTCACAGG + Intronic
1124314678 15:28657723-28657745 TTAGCCATCCTGAATGTCACAGG - Intergenic
1124367399 15:29081927-29081949 ACAGCAACTCTGATAGACACGGG + Intronic
1127895460 15:63294893-63294915 TCAGAAATTCTGGAAGGCAGTGG + Intronic
1131327178 15:91459268-91459290 TAAGCATTTCTGAAACTCATTGG - Intergenic
1135842449 16:25888962-25888984 TCAGCAGTTCTGAAAGGAAGCGG - Intronic
1136694707 16:32067238-32067260 CCAGCTCTTCTCAAAGTCACAGG - Intergenic
1136795209 16:33010500-33010522 TCAGCTCTTCTCAAAGTCACAGG - Intergenic
1136870079 16:33798861-33798883 TCAGCTCTCCTCAAAGTCACAGG - Intergenic
1136874709 16:33843882-33843904 TCAGCTCTTCTCAAAGTCACAGG + Intergenic
1137052092 16:35723028-35723050 TCAGCAATGCAGAAAGAAACCGG - Intergenic
1203097462 16_KI270728v1_random:1272160-1272182 CCAGCTCTTCTCAAAGTCACAGG - Intergenic
1203102092 16_KI270728v1_random:1317193-1317215 TCAGCTCTCCTCAAAGTCACAGG + Intergenic
1143782090 17:9234254-9234276 TCAGCAATTCTGGGGTTCACAGG - Intronic
1145727139 17:27140546-27140568 TCACGAATACTGAAATTCACAGG - Intergenic
1149694003 17:58601991-58602013 TCAGTCATCCTGAATGTCACTGG + Intronic
1149707232 17:58705902-58705924 TCATCAACTCTAAAAGTCCCAGG + Intronic
1150864933 17:68839803-68839825 TAAGCAATTCCGAAGTTCACTGG + Intergenic
1152027455 17:77821113-77821135 ACAGAAATGCTGAAAGTCAAAGG + Intergenic
1152122445 17:78427050-78427072 TCAGCCATGTTGAAAGTCTCCGG + Exonic
1160283989 18:77522030-77522052 ACAGCACTTCTGGAAGTCATTGG + Intergenic
1163155206 19:15436549-15436571 TAAGCATTTGTCAAAGTCACTGG + Intronic
1165573002 19:36791380-36791402 ACACCGATTCTCAAAGTCACAGG + Intergenic
1165621369 19:37251542-37251564 ACACCCATTCTCAAAGTCACAGG + Intergenic
1166120833 19:40685253-40685275 TCAGCCATCCTGACAGTCCCAGG + Intronic
925214464 2:2082803-2082825 CCAGCATATCTGAAAGCCACTGG - Intronic
925261764 2:2535469-2535491 CCAGCAATTCTGAAAATTAATGG + Intergenic
926363778 2:12114652-12114674 TCATCAAATCTGAGAATCACAGG - Intergenic
928345025 2:30484362-30484384 TCAGTCATTTTGAAAGCCACAGG + Intronic
929301021 2:40303811-40303833 TCAGCAATTGTGTATGTCTCAGG - Intronic
929782611 2:44966828-44966850 TCACCATTTCTGAAAGACTCAGG + Intergenic
930924046 2:56794559-56794581 ACAACAATTCTGTAAGTCTCAGG + Intergenic
931675520 2:64692403-64692425 TCAGAAATTCAGAAATTCAGGGG + Intronic
935600518 2:104917486-104917508 TGAGCAAGTCTGAAGGTAACAGG + Intergenic
937057612 2:118952673-118952695 TCAGCAATGCAGAAAGAAACTGG - Intronic
938208056 2:129440355-129440377 TCAGCAATTCTGGAAGAGAAAGG + Intergenic
938688616 2:133765582-133765604 TAAGGAAATCTTAAAGTCACAGG - Intergenic
939028707 2:137044842-137044864 TCAGGAATTCAGAAGGTCAGTGG - Intronic
940348786 2:152657465-152657487 TCAGTATTTCTAAAAGTTACTGG + Intronic
943245098 2:185436944-185436966 TAAGCAAGTCTGAAATTCAGAGG + Intergenic
943701146 2:190989231-190989253 TCAGCAAGTCTCAAAGTGGCTGG - Intronic
943965318 2:194325644-194325666 TCAGCAATTTTGAAATACATTGG - Intergenic
944159201 2:196640900-196640922 TCAGTGATTCTCAGAGTCACTGG - Intronic
944466328 2:200003679-200003701 TCTGCAGTTCTGGAGGTCACTGG + Intronic
945052292 2:205835610-205835632 TCAGCAGTTCTGAAGATGACAGG - Intergenic
946048728 2:216843100-216843122 TCAGCAACTCAGACATTCACAGG - Intergenic
948048356 2:234960593-234960615 TCAGCAGTTCTGAAAATCACAGG - Intronic
948103824 2:235396870-235396892 TCAGCACATCTGAAAGTCCCTGG - Intergenic
948888576 2:240896214-240896236 CCAGCAATTGGGAATGTCACAGG + Intronic
1172269243 20:33644333-33644355 CCAGCAGTTCTGCAAGACACAGG - Exonic
1172289969 20:33769248-33769270 ACAGCAGTTCTCAAAGTCCCAGG + Intronic
1172477032 20:35246826-35246848 TAACCAGTTCTGAAAGACACGGG - Exonic
1176257709 20:64160760-64160782 TCAGCACTTCTGCAAGCCACGGG - Intronic
1176300509 21:5096834-5096856 TCAGCACTTCTGAAGGTTCCTGG + Intergenic
1177260427 21:18722873-18722895 TCAGCAATTATGAACCACACTGG - Intergenic
1177735170 21:25080165-25080187 TCAGCTTTTCAGAATGTCACTGG - Intergenic
1178512309 21:33215743-33215765 TGAGCAATTCTGAGAATCAGAGG + Intergenic
1179856534 21:44165147-44165169 TCAGCACTTCTGAAGGTTCCTGG - Intergenic
1183004876 22:34892815-34892837 TCAGCAATTTTTAAAGTCATAGG + Intergenic
1184071283 22:42149063-42149085 TCAGCAAAGATGAAAGGCACAGG - Intergenic
1184353219 22:43958875-43958897 TCAAAAAGTCTGAAAGACACTGG - Intronic
1184825619 22:46948851-46948873 TCAGAAAATCAGAAAATCACCGG + Intronic
949692812 3:6660594-6660616 CTAGCAAATCTGAAATTCACAGG - Intergenic
950986161 3:17369972-17369994 TCAGCAATACTGAAAATACCAGG - Intronic
951307482 3:21083258-21083280 AAATCTATTCTGAAAGTCACTGG - Intergenic
953009315 3:39009487-39009509 TCAGCAATTCTCAAACTTTCTGG - Intergenic
957557239 3:81778413-81778435 TCAGCAATTATGAGAATCATGGG - Intergenic
958571960 3:95895204-95895226 TCAGCAATTCTGCAAATAAAGGG + Intergenic
959173267 3:102870491-102870513 TCAGCCATTGTTAAAGTCCCTGG + Intergenic
959979237 3:112496559-112496581 TCAGCAATTAAGTAAATCACAGG + Intronic
961582047 3:127891255-127891277 TCAGCAATACTGAAAGAAACTGG + Intergenic
964555227 3:157929918-157929940 TCAGCAATTCTGAAGGTAAAGGG - Intergenic
964841611 3:160999691-160999713 CCAGGACTCCTGAAAGTCACTGG - Intronic
965424313 3:168502505-168502527 TCAGGCATTTTGATAGTCACTGG - Intergenic
966144443 3:176793848-176793870 TAAGTATTTCTGAAAATCACTGG - Intergenic
968032817 3:195517170-195517192 TGAACATTTCTGTAAGTCACAGG + Intronic
971073530 4:23122728-23122750 ATAGCAATTCTCAAAGTCACTGG - Intergenic
971083794 4:23246531-23246553 TCAGCTATTGTGAAAGGCAGAGG + Intergenic
977859466 4:101938943-101938965 CCCACATTTCTGAAAGTCACAGG + Intronic
979956627 4:126961075-126961097 TAAGAAATACTGAAAGACACAGG + Intergenic
981149942 4:141368884-141368906 CCAGCAATTCTGAACAACACCGG + Intergenic
981311965 4:143306302-143306324 GCAGCACATCTGAAAATCACTGG + Intergenic
981593535 4:146392538-146392560 TCAGTAAATCTGAAGGTCATAGG - Intronic
985343481 4:188975934-188975956 TCAGCAATATTTAAATTCACTGG - Intergenic
985794069 5:1949240-1949262 TTGGAAGTTCTGAAAGTCACAGG + Intergenic
986147812 5:5095660-5095682 TCAGCAAATCAGGAAGCCACGGG + Intergenic
989337227 5:40331931-40331953 TCAGCACTTCTGGGGGTCACTGG + Intergenic
989453949 5:41620429-41620451 TTAGGCATTCTGAAAGTCAGAGG + Intergenic
990712313 5:58598783-58598805 TCAGAAATTATGAAAGTCTCAGG + Intronic
993030915 5:82704726-82704748 TCAGGTATTCTGTAAGACACTGG + Intergenic
993248301 5:85481013-85481035 TCAGGAATTCTGCAAATCAGTGG - Intergenic
996284048 5:121768091-121768113 TCTGTAATTCTGAAAGTAAGAGG + Intergenic
997825700 5:137105131-137105153 GCAGCAATTAGGCAAGTCACTGG - Intronic
1000266821 5:159646137-159646159 TTAGTAAGTCTGAAAGTCTCAGG + Intergenic
1000584085 5:163074293-163074315 TCAGAAATTGTGAAAATCAGAGG + Intergenic
1000734750 5:164885332-164885354 TCAGCAAGTCTGACACTGACAGG + Intergenic
1001376512 5:171264746-171264768 TCAGCAACTCAGAAAGTAATTGG + Intronic
1002995644 6:2281812-2281834 ACATCAATTCTGAAGTTCACAGG + Intergenic
1005006753 6:21294965-21294987 TCAGAAATTCAGAAAGGCACAGG - Intergenic
1006282398 6:33065222-33065244 TCAGCAATTCAGTCAGCCACTGG + Exonic
1006464993 6:34188077-34188099 ACAGCAAGTCTGAAAGTCAAAGG + Intergenic
1007908356 6:45487438-45487460 TAAGCATTGTTGAAAGTCACTGG - Intronic
1007984364 6:46192908-46192930 ACCTCAATTCTGAAAGTAACAGG - Intergenic
1009884325 6:69606493-69606515 TCAGCAATTTTGAAATTCACAGG - Intergenic
1010042692 6:71405261-71405283 TCAGCAATTCTCAAAGTGAGAGG - Intergenic
1010042710 6:71405609-71405631 TCAGCAATTCTCCAAGTGAGAGG + Intergenic
1012104700 6:95141473-95141495 TGAGCAATGCTGAAAGATACTGG - Intergenic
1013422365 6:109978437-109978459 TCAGGACTTCTGGAAGTCGCTGG - Exonic
1013604479 6:111735019-111735041 TCAGCAATTGAGAAAGTGACTGG + Intronic
1013801134 6:113945092-113945114 TCAGCACTTCTGAGAGGCAGAGG + Intronic
1014056421 6:117020963-117020985 TCAGCACTTTTAAAGGTCACTGG - Intergenic
1015101994 6:129492334-129492356 TCAGCATTTTTGAAGGACACAGG - Exonic
1016131640 6:140480196-140480218 TCAGCAATTTTGAAATTCAAAGG + Intergenic
1016167229 6:140961756-140961778 TCCTCATTTCTGAAAGTCATAGG + Intergenic
1016172441 6:141036033-141036055 TGAGCAATTCTGAAACTCGTTGG - Intergenic
1017714101 6:157196112-157196134 TAGGCATTTCTGAAAGTCAAAGG - Intronic
1018084899 6:160292399-160292421 TCAACAATGCTGTAAGTAACTGG + Intergenic
1018862637 6:167722219-167722241 TCAGCAACTCAGAAAGCAACTGG - Intergenic
1018890976 6:167981851-167981873 TCAGCAATGATGGAAGTCAGAGG + Intergenic
1018968243 6:168505838-168505860 TGCACAATTCTGAAAGTCACTGG - Intronic
1020653571 7:10904051-10904073 TTAGCAATTCTGAAATCTACAGG + Intergenic
1022533663 7:31082616-31082638 TCAGAAAGTCTGAATGTCCCAGG - Intronic
1024467990 7:49733993-49734015 TCACCAATTTTGATAGCCACTGG + Intergenic
1030280905 7:107774219-107774241 TCAGTGCTTCTGAAACTCACTGG - Intronic
1030406747 7:109124428-109124450 TCAGTAATACTCAAAGCCACTGG + Intergenic
1030866465 7:114706376-114706398 TCAGAGATTCTGAATCTCACTGG + Intergenic
1030912920 7:115275273-115275295 TCAGGAATTCTGCTAGACACTGG - Intergenic
1038861246 8:31391207-31391229 TCACCTATTCAGAAAGTCAGGGG + Intergenic
1040749254 8:50685497-50685519 TCAGAGATTCTGAAATTTACAGG - Intronic
1044031693 8:87246346-87246368 TCAACAATTCTGATAGTTATTGG - Intronic
1045439672 8:102197191-102197213 TTAGCAAATATCAAAGTCACAGG + Intergenic
1050763812 9:9107800-9107822 TCATCAATCCTGAAGGTGACAGG - Intronic
1051024483 9:12590502-12590524 TCAGCAATGCTACAAGGCACAGG + Intergenic
1052154688 9:25170572-25170594 TGTGCAATTCTGAAAGCCACTGG + Intergenic
1052232053 9:26165421-26165443 GCACCAATTCTTAAAGTCTCTGG - Intergenic
1055050730 9:71977777-71977799 TCAGCAATACTGAATGTTACAGG + Intronic
1055070812 9:72163790-72163812 CCAACTATTCTTAAAGTCACAGG + Intronic
1055999442 9:82198649-82198671 TCAGCAATTAGGAAACTCACTGG + Intergenic
1056123543 9:83512775-83512797 TCAGAGATGCTGAAAGACACCGG - Intronic
1057768950 9:97949975-97949997 TCAGCATACCTGAAAGTGACGGG - Intergenic
1058608872 9:106753437-106753459 TGAGCACTTCTGCAAGTCAAGGG + Intergenic
1059150561 9:111946080-111946102 TCGGCAATACTGAAGGTTACTGG + Intergenic
1059633663 9:116152693-116152715 TCTGAAATTGTTAAAGTCACAGG - Intergenic
1060606533 9:124919699-124919721 TCAGCAATTCTGAAAGATGAGGG + Intronic
1060607715 9:124932101-124932123 TCAGCAATTGTGAAAGTAGATGG - Intronic
1186562682 X:10629699-10629721 TCAGCAATTCTGAATGGAAAAGG - Intronic
1186712821 X:12218270-12218292 TAACCATTTTTGAAAGTCACTGG - Intronic
1186920553 X:14274537-14274559 TCAGAAATTTTGCAAGCCACTGG - Intergenic
1187115427 X:16345293-16345315 TCAGAAATGCTAAAAGTCATAGG + Intergenic
1189607637 X:42696686-42696708 TCAGCTGTTCTGAAACTCAGTGG - Intergenic
1189909515 X:45795799-45795821 TCAGTAATTCTGTGAGTCAATGG + Intergenic
1190337864 X:49273633-49273655 TCAACAGTGCTGCAAGTCACTGG - Intronic
1193580135 X:83253779-83253801 TCAGAAATTCTGAAAATAAAAGG + Intergenic
1196276985 X:113778043-113778065 TAATCAATTCTAGAAGTCACTGG + Intergenic
1198147364 X:133870818-133870840 TTAGCAACTCTAAAAGTCATTGG - Intronic
1198593816 X:138214436-138214458 TCTGCCATTTTGGAAGTCACTGG + Intergenic
1199182565 X:144875968-144875990 TCAGAAATTCTGAAATGCTCAGG - Intergenic
1199542935 X:148977866-148977888 TCAGAAATGCCTAAAGTCACTGG - Intronic
1199790924 X:151154525-151154547 ACTGCACTTCTGAAAATCACAGG - Intergenic
1201634688 Y:16109509-16109531 TCTGCATTTCTGAATATCACTGG - Intergenic