ID: 1066180288

View in Genome Browser
Species Human (GRCh38)
Location 10:32955848-32955870
Sequence TCTCATGTGCAGAATGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066180285_1066180288 9 Left 1066180285 10:32955816-32955838 CCAGTGACTTTCAGAATTGCTGA 0: 1
1: 0
2: 3
3: 24
4: 206
Right 1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066180288 Original CRISPR TCTCATGTGCAGAATGTTGA GGG Intronic
No off target data available for this crispr