ID: 1066180477

View in Genome Browser
Species Human (GRCh38)
Location 10:32957563-32957585
Sequence CCGCCCGCGGCGCTGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 413}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066180458_1066180477 29 Left 1066180458 10:32957511-32957533 CCCGGTCCCCAGCGGCTCCACTA 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180465_1066180477 4 Left 1066180465 10:32957536-32957558 CCAACTTCTACCCGGCTCCCGCC 0: 1
1: 0
2: 0
3: 13
4: 208
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180466_1066180477 -6 Left 1066180466 10:32957546-32957568 CCCGGCTCCCGCCGCCCCCGCCC 0: 1
1: 3
2: 28
3: 302
4: 2156
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180457_1066180477 30 Left 1066180457 10:32957510-32957532 CCCCGGTCCCCAGCGGCTCCACT 0: 1
1: 0
2: 2
3: 12
4: 253
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180463_1066180477 12 Left 1066180463 10:32957528-32957550 CCACTAAGCCAACTTCTACCCGG 0: 1
1: 1
2: 0
3: 6
4: 94
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180459_1066180477 28 Left 1066180459 10:32957512-32957534 CCGGTCCCCAGCGGCTCCACTAA 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180462_1066180477 21 Left 1066180462 10:32957519-32957541 CCAGCGGCTCCACTAAGCCAACT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180460_1066180477 23 Left 1066180460 10:32957517-32957539 CCCCAGCGGCTCCACTAAGCCAA 0: 1
1: 0
2: 1
3: 8
4: 92
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180461_1066180477 22 Left 1066180461 10:32957518-32957540 CCCAGCGGCTCCACTAAGCCAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413
1066180467_1066180477 -7 Left 1066180467 10:32957547-32957569 CCGGCTCCCGCCGCCCCCGCCCG 0: 1
1: 1
2: 25
3: 295
4: 1823
Right 1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066180477 Original CRISPR CCGCCCGCGGCGCTGGCCCC AGG Intronic
900031572 1:376379-376401 CCCCACGCAGCGCTAGCCCCTGG - Intergenic
900052123 1:604579-604601 CCCCACGCAGCGCTAGCCCCTGG - Intergenic
900090163 1:916751-916773 CTTCCCTCGGCGCCGGCCCCGGG - Intergenic
900176736 1:1294469-1294491 CTGGCGGCGGCGCTGGCCCACGG - Exonic
900240665 1:1615878-1615900 ACCCCAGCGCCGCTGGCCCCGGG - Intronic
900368168 1:2319943-2319965 CCGCCCGCCCCTCTGCCCCCGGG + Intergenic
900556276 1:3282437-3282459 GGCCCTGCGGCGCTGGCCCCAGG - Intronic
900633268 1:3649856-3649878 CCGCCCCCGGCCCTGCCCGCCGG + Intronic
901007723 1:6179902-6179924 GCCCCCGCCGCTCTGGCCCCAGG + Intronic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901443396 1:9292945-9292967 CCGGCCCCGGCGCCGGCGCCTGG - Exonic
901489327 1:9588799-9588821 CCGCCTGCGGCCCGCGCCCCCGG + Intergenic
901659088 1:10787505-10787527 CCGCCCGCCCCCCTCGCCCCCGG - Intronic
902263933 1:15247586-15247608 CCGCCCGCGGAGGAAGCCCCCGG + Intronic
902916876 1:19644662-19644684 CCGGACGCGGCGGTGCCCCCCGG - Intronic
903349896 1:22711143-22711165 CTGCGCCCGGCGCCGGCCCCCGG - Intronic
903462298 1:23528428-23528450 CTGCCCACGGGGCTGGGCCCCGG + Intronic
903750581 1:25618050-25618072 GCCCCCGCCGCGCCGGCCCCGGG + Exonic
904037925 1:27568697-27568719 CCGGCCGCGGCGCGGGTGCCCGG + Intronic
904500126 1:30908533-30908555 CCGCCCACGGGGCCGGCGCCGGG - Exonic
904696779 1:32335696-32335718 CGGTCCCCGGCGCTGCCCCCCGG - Intronic
904831107 1:33307325-33307347 CCCCGCGTGGCGCTGGGCCCGGG - Exonic
905202154 1:36322606-36322628 CCGCCCGCGGCCCCGGGGCCCGG - Exonic
905734672 1:40316987-40317009 CTGCCCGCGGCGCTGTCCTCAGG + Intronic
905883053 1:41476903-41476925 CCGCCCTTGGCACAGGCCCCGGG - Intergenic
906027205 1:42683177-42683199 AGGCCCGGGGCGCGGGCCCCAGG - Intronic
906365419 1:45205968-45205990 CCGCCAGCAGCGCCGGCGCCGGG + Exonic
907223879 1:52927290-52927312 CCGCCCGCGGCCCTGGCTTCGGG + Exonic
907909719 1:58815406-58815428 CCGCCCGCAGCGCCGGGCCGCGG + Intergenic
912471678 1:109911070-109911092 ACGGCCGCGGCGCTGGGCCCGGG + Intronic
912798553 1:112707052-112707074 CCGCCCGCAGCCCCGGCCCAGGG + Intronic
913714360 1:121519223-121519245 CTGCCCGCGGCACTGGCTGCGGG + Intergenic
914860444 1:151381602-151381624 CCACCAGCTGCGCTGGACCCTGG - Intergenic
915246293 1:154558472-154558494 CGGCCCCCGGCGCCGCCCCCTGG + Exonic
915932749 1:160070171-160070193 CCGACCCCGGCCCCGGCCCCCGG - Exonic
917919988 1:179743332-179743354 CCGCCCCAGCCGCTGGCGCCCGG + Exonic
917974702 1:180231089-180231111 ACGCCCGGGGCGCGGGCCGCAGG - Intronic
920002331 1:202808253-202808275 CCGCGCCCGGCGCTGCCCCTCGG - Exonic
922416561 1:225427858-225427880 CCGGCCGCTGCGCCGGCCTCGGG + Intronic
923055920 1:230425988-230426010 CGGGCCGCGGCGCGGGCCCAGGG - Intergenic
923429343 1:233905393-233905415 TCTGCCGCGGCGCTCGCCCCCGG + Intronic
923506555 1:234610026-234610048 TCGGGCGCGGCGCGGGCCCCGGG + Intergenic
1063395635 10:5684968-5684990 GCGCCCGCGGCGAGGACCCCGGG + Exonic
1063848782 10:10161306-10161328 CCGCCTGCAGCCCTGGCACCGGG + Intergenic
1064274203 10:13891779-13891801 CCGCCCCCGCCGCGGGCCCTCGG + Intronic
1065024204 10:21526066-21526088 CCGCCCCCGCCGCCAGCCCCGGG + Intergenic
1065883713 10:30059173-30059195 CGGCCCGCGGTGCCCGCCCCGGG + Intronic
1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG + Intronic
1066220800 10:33335312-33335334 CCGCCGAGGGCGCGGGCCCCGGG - Intronic
1067584826 10:47469316-47469338 CCACCCCCGGCCCTGCCCCCAGG - Intronic
1069186533 10:65429670-65429692 CCGCCAGCCCCGCCGGCCCCGGG - Intergenic
1070305347 10:75235879-75235901 GTGCCCGCCGCGCTGGCCCTGGG - Exonic
1070768623 10:79070069-79070091 TCTCCGGCGGCGGTGGCCCCGGG + Intronic
1071559243 10:86632422-86632444 CCGCACACTGCGCTGGCCCGCGG + Intergenic
1072757282 10:98029887-98029909 CCGCGCGCGGGGCTGGCTCCCGG + Intronic
1073262502 10:102201130-102201152 CGGCCAGCGCCGCCGGCCCCAGG - Intergenic
1073338342 10:102727164-102727186 CCTCCCACGGCCCTGCCCCCAGG - Intronic
1075859409 10:125661778-125661800 GTGCCAGCGGCGCTGCCCCCTGG + Intronic
1075999716 10:126905290-126905312 CCGCCCTCGGCGCGGACCCTGGG - Intergenic
1076894530 10:133303382-133303404 CTGCCCACGGGGCTGGCTCCCGG - Intronic
1077010362 11:376737-376759 GCGCACGCGGCGCTGGGGCCCGG - Exonic
1077043721 11:535436-535458 TCGGCCCCGGCCCTGGCCCCGGG - Exonic
1077204937 11:1337495-1337517 CCGCCCCCGCCTCGGGCCCCCGG - Intergenic
1077500112 11:2905667-2905689 CAGCCCTCGGAGCAGGCCCCAGG - Intronic
1078088902 11:8251638-8251660 CAGCCCCCGGCGCTGGTCCAGGG + Intronic
1078726982 11:13940485-13940507 CCACCCGCTGCCCTGGGCCCAGG - Intergenic
1080779716 11:35419200-35419222 CCGCCCGCGGGGATGGCGCTTGG + Exonic
1081872992 11:46391677-46391699 CCGCCCGCCCCGCCGGCCCGCGG - Intergenic
1081938065 11:46918384-46918406 CCGCCCGCGCCGCTCGCCCGGGG + Exonic
1082159945 11:48880087-48880109 CCGCCCACGCCTCAGGCCCCCGG + Intergenic
1083665010 11:64269495-64269517 ACCCGGGCGGCGCTGGCCCCGGG + Intergenic
1083672569 11:64307276-64307298 CCTCCTGTGGCCCTGGCCCCTGG + Exonic
1083992824 11:66257578-66257600 CCGCCCGGGGCGCAGTTCCCAGG - Intronic
1084028529 11:66467303-66467325 CCGCCCGGGGCGCAGGGCGCGGG + Intronic
1084192199 11:67504361-67504383 CCGCCCGCGCCGCCGGGGCCGGG + Intronic
1084301660 11:68256455-68256477 CCTCCCCCGCCGCTGTCCCCTGG + Intergenic
1084656465 11:70522638-70522660 CAGCCCGCGGAGCTGGAGCCGGG - Intronic
1085502999 11:77039729-77039751 CCGCCCTCGGAGCTCGTCCCCGG + Exonic
1086484714 11:87286467-87286489 CCGCCCGTGGCCCTGGCGCAGGG - Intronic
1088686739 11:112290203-112290225 CCGCCCGCGTCCCCGCCCCCCGG - Intergenic
1088801905 11:113314499-113314521 CCGCCCCGGGCCCTGGCTCCTGG + Intergenic
1089564661 11:119364294-119364316 CCGCCCCCGGCGCCGGCACGCGG + Intronic
1091915342 12:4269227-4269249 CGGGTCGCGGCGCTGGCTCCGGG + Intergenic
1092230663 12:6773807-6773829 CCTCCCGCTGCGCAGGCCTCCGG - Exonic
1096749834 12:53751699-53751721 CGGCCCGCTGCCCTCGCCCCGGG - Intergenic
1096769771 12:53927741-53927763 CCGCCCGCTGCTTTGGCCTCCGG + Intergenic
1096796742 12:54082573-54082595 CCGGCCCCGGCCCCGGCCCCCGG - Intergenic
1097218238 12:57430756-57430778 CCGCCCGCCGCCCGGGCCCACGG + Exonic
1099413720 12:82361679-82361701 CGGCCAGCACCGCTGGCCCCAGG - Intronic
1100632219 12:96400275-96400297 GCGCCCGCCGCGCTCGCGCCCGG - Exonic
1101371730 12:104137609-104137631 CCACCCGCCGCGCGGCCCCCGGG + Intronic
1102853910 12:116277346-116277368 CGGCCCGCAGCGCCGGCCCGGGG - Intergenic
1102962041 12:117099284-117099306 GTGCCCGCGGCGGGGGCCCCGGG + Exonic
1104937835 12:132375983-132376005 CTGCCCGGGGCGCTGGGCTCTGG - Intergenic
1104961492 12:132490353-132490375 CCGCCCGCGCCGGGGGTCCCAGG + Exonic
1105344598 13:19561140-19561162 CCTCCTGTGGCCCTGGCCCCTGG - Intergenic
1105535440 13:21260433-21260455 CCTCCTGTGGCCCTGGCCCCTGG + Intergenic
1105593873 13:21818042-21818064 CGGCCGGCGCCACTGGCCCCAGG + Intergenic
1105857849 13:24387714-24387736 CCACCCTTGGCGCTGCCCCCAGG - Intergenic
1105874728 13:24541537-24541559 CAGCCCGCTCCTCTGGCCCCGGG + Intergenic
1106665412 13:31846597-31846619 CCGCCAGCAGCGCGCGCCCCCGG + Intergenic
1107133347 13:36919730-36919752 CCGCCCGCGCCGCGGGCCCCGGG - Intronic
1107711228 13:43152375-43152397 CTGCCCCCGGCCCAGGCCCCAGG + Intergenic
1108688969 13:52845992-52846014 CCGCCCGGGGAGCCGGGCCCAGG - Exonic
1108845656 13:54676669-54676691 CCACCGGCGCCACTGGCCCCAGG + Intergenic
1109284876 13:60397638-60397660 CCGCCCGCCGCCCGGGGCCCAGG - Intronic
1109630144 13:65034494-65034516 CCCTCCGCGGCTCTGGACCCTGG - Intergenic
1111220895 13:85205011-85205033 CGGCTGGCGCCGCTGGCCCCGGG + Intergenic
1111556160 13:89884002-89884024 CTCCCCGCGGGGCTGGCCTCGGG - Intergenic
1111747675 13:92290987-92291009 CTGCCAGCCCCGCTGGCCCCAGG + Intronic
1112506496 13:99979498-99979520 ACGCCCGAGGCGCTGGCCTCAGG + Intergenic
1112507736 13:99985201-99985223 CCCCCCGCCGCCCTGGCCCCTGG - Intronic
1113378128 13:109782938-109782960 CCGCCACCGCCGCCGGCCCCGGG - Exonic
1114056923 14:18978270-18978292 CAGCCCCCTGCTCTGGCCCCTGG + Intronic
1114105623 14:19423476-19423498 CAGCCCCCTGCTCTGGCCCCTGG - Intronic
1115851235 14:37591948-37591970 CCGCCCCCGCCGCCGGCCCCCGG + Exonic
1115906692 14:38209477-38209499 CCGTCCGCAGCGCCGGCCCCGGG - Exonic
1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG + Intergenic
1118971456 14:70641801-70641823 CCCCCCGCAGCGCTAGTCCCGGG + Exonic
1119392845 14:74302874-74302896 CCGCGCCCGGAGCTGGCGCCAGG - Exonic
1121342965 14:93115939-93115961 CGGCGGGCGGCGCTGCCCCCTGG - Intronic
1122108688 14:99480567-99480589 CCGCCGGCCGCTGTGGCCCCGGG - Intronic
1122597430 14:102903111-102903133 CCACCCGCGGCTCTGACTCCAGG - Intronic
1122625619 14:103084124-103084146 CCCACCGCGGGGCTGGCCGCCGG - Intergenic
1122960975 14:105093518-105093540 CCGCCCCCGGCCCGCGCCCCGGG + Intergenic
1123048172 14:105528352-105528374 ACGCCCGCGCTGCTGGCCTCAGG - Intronic
1123799130 15:23803012-23803034 CGGCCGGCGGTGCGGGCCCCAGG + Intergenic
1125479789 15:40072220-40072242 CAGCCCTCGGAGCTGTCCCCAGG + Intergenic
1125599323 15:40906847-40906869 CCGCACTTGGCGCTGCCCCCTGG + Intergenic
1127753620 15:62068641-62068663 CCGGCCGCGGCCCTCGTCCCGGG - Exonic
1128067907 15:64775712-64775734 CCGCCCGCCGCGCGGTCTCCGGG + Intergenic
1128074523 15:64817997-64818019 CCGACTGAGGAGCTGGCCCCCGG + Exonic
1128547706 15:68579108-68579130 CCGCCCGGAGCGCAGCCCCCAGG + Exonic
1129644693 15:77419723-77419745 CCTCCCTCGGCGGCGGCCCCGGG - Intronic
1131257488 15:90871825-90871847 CCACCCTCGGGGCCGGCCCCGGG - Intronic
1131431943 15:92394625-92394647 CCGCCCTCCGCTCCGGCCCCAGG - Intronic
1131517552 15:93089157-93089179 CCGCCCGAGCCGCTGGGCCGGGG - Intronic
1131517604 15:93089309-93089331 CCGCCCGCGGCCCGGGCGCCCGG - Intergenic
1131871004 15:96764696-96764718 CCGCCAGCCGCGCTCGCCCATGG + Intergenic
1132628165 16:902205-902227 CCGGCTGCTGCGCTGGCCCAGGG - Intronic
1132700738 16:1221009-1221031 CCGCCCACGGCTTTGGCCCTGGG + Exonic
1132779351 16:1614311-1614333 CCGGCCCCGGCCCCGGCCCCGGG - Intronic
1132954404 16:2583855-2583877 GCACCCCCGGCACTGGCCCCGGG + Intronic
1132959941 16:2616308-2616330 GCACCCCCGGCACTGGCCCCGGG - Intergenic
1133771251 16:8868426-8868448 CCGCCGGGCGCGCTGGGCCCGGG - Intronic
1134092589 16:11399490-11399512 CCGCATGCGGTGCTGGCCCCAGG + Exonic
1135557923 16:23452798-23452820 CCGCTCGGGGCCCTGGCCGCGGG - Intronic
1135577421 16:23596387-23596409 CCGCCGGCGGTGGCGGCCCCTGG + Intergenic
1136283693 16:29229394-29229416 CCACCCGAGGCGAGGGCCCCTGG + Intergenic
1136317031 16:29460479-29460501 CCGCACGAGGCTCTAGCCCCTGG + Intronic
1136431606 16:30199821-30199843 CCGCACGAGGCTCTAGCCCCTGG + Intronic
1136778146 16:32882358-32882380 CAGCCCCTGGGGCTGGCCCCAGG + Intergenic
1136892475 16:33979156-33979178 CAGCCCCTGGGGCTGGCCCCAGG - Intergenic
1137033123 16:35543668-35543690 CAGGCCCCGGCGCTGGGCCCCGG + Intergenic
1137231276 16:46569699-46569721 CCTCCAGCAGCGCGGGCCCCGGG - Intergenic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137614562 16:49838913-49838935 CGGCCCGCGGGGGCGGCCCCGGG - Intronic
1137787445 16:51150750-51150772 GCGCTCCCGGCGCCGGCCCCAGG - Intronic
1138567557 16:57844656-57844678 CCGCCCCCTCCGCAGGCCCCAGG + Intronic
1138591064 16:58000175-58000197 CCGCCCTCGGGGCTCGCCCTCGG - Intronic
1139433774 16:66925019-66925041 CTGCAGGCGGCGCTGACCCCGGG - Exonic
1139534448 16:67562808-67562830 CCGGCGGCGGCGCTGGCGCCGGG - Intronic
1141626857 16:85266031-85266053 CAGGCCGCGGCGCTGGGCTCTGG + Intergenic
1142088728 16:88198905-88198927 CCACCCGAGGCGAGGGCCCCTGG + Intergenic
1142127071 16:88415444-88415466 CCCCCCGCAGCACAGGCCCCTGG - Intergenic
1203080565 16_KI270728v1_random:1144467-1144489 CAGCCCCTGGGGCTGGCCCCAGG + Intergenic
1142631591 17:1229434-1229456 CCGCAGGCCGCGCTGGCCCGGGG - Intergenic
1142671070 17:1487595-1487617 ACGCCCGCTGCGGTGCCCCCAGG + Intronic
1142763420 17:2053840-2053862 CCGCCCCCCGCGCTGTCCTCTGG - Intergenic
1142764294 17:2056973-2056995 GCGGCCGCGGCCGTGGCCCCGGG + Exonic
1143183529 17:4998020-4998042 CCGCCCGCCGCCCGGGCACCCGG + Exonic
1143377840 17:6477946-6477968 CCTCCCGCGGTCCTGTCCCCCGG + Intronic
1143461601 17:7107971-7107993 CAGGACGAGGCGCTGGCCCCCGG - Intronic
1143513573 17:7408316-7408338 CCGCCCGGGGCGCCGCCGCCGGG - Exonic
1143596312 17:7916281-7916303 GAGGCCGCGGCGCCGGCCCCAGG - Intergenic
1144107284 17:11997433-11997455 CGGCCCGCGGCGCCGGCTCCGGG + Intronic
1144340266 17:14304122-14304144 CCGCTCGCAGCGCAGCCCCCGGG - Intronic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1145962817 17:28897404-28897426 CGGCGCAGGGCGCTGGCCCCCGG - Intronic
1147580532 17:41625011-41625033 CCACCCACGGTGCTGGCCCCGGG + Intergenic
1147879758 17:43646101-43646123 CCGCCCGCGGGGCGCGCCCGGGG + Intronic
1148909207 17:50931572-50931594 GCGCGAGCGGCGCTGGGCCCTGG - Intergenic
1149491262 17:57086211-57086233 CCGCCTGCGGCCCAGGGCCCGGG + Intronic
1149994632 17:61400133-61400155 CCGGCCCCGGCCCCGGCCCCCGG + Exonic
1150764632 17:67993570-67993592 CGCGCCGCCGCGCTGGCCCCGGG - Intronic
1151743738 17:76000880-76000902 CCCCCAGTGGCCCTGGCCCCTGG + Intronic
1152523422 17:80873589-80873611 CCGCCTGGGGCCCTGTCCCCGGG - Intronic
1152596156 17:81238809-81238831 CCGCCCGCCGCGCCGTCCCGGGG - Intronic
1152834584 17:82520545-82520567 CCGCCCGCAGCCCCGGCTCCAGG - Intronic
1152948081 17:83209334-83209356 CCCCACGCAGCGCTAGCCCCTGG + Intergenic
1153201906 18:2655732-2655754 CCGGCGGCGGCGCTGGTCGCGGG + Exonic
1153935158 18:9914412-9914434 ACGTCCGCGGCCCTGGCCCGAGG + Intronic
1154255326 18:12777116-12777138 CCGGCCGGGCCGCCGGCCCCGGG - Intergenic
1155199348 18:23503586-23503608 GCGCCCGCGGCGGGGGCCCCGGG - Exonic
1156243056 18:35271908-35271930 CGGCCAGCGCCGCCGGCCCCAGG - Intronic
1156448561 18:37253980-37254002 CCGCCCGGGGCGCTGCCGGCGGG + Intronic
1158259047 18:55587927-55587949 CCTCCCGCGCCGCGGGCTCCCGG - Intronic
1160389480 18:78519129-78519151 CCGCACGCGAGGCTGGCCTCGGG - Intergenic
1160568072 18:79798927-79798949 CCGCCCGCGCGCCTGGCTCCCGG + Intergenic
1160749718 19:728090-728112 CCGCCAGCTGGGCTGGCGCCAGG - Intronic
1160945964 19:1644256-1644278 CAGGCTGTGGCGCTGGCCCCAGG - Intronic
1160999972 19:1905640-1905662 GCGCGCGCGGCGCTGGCCTGGGG + Intronic
1161022126 19:2015507-2015529 CCGCCCGCCCCGCCGGGCCCCGG - Exonic
1161038239 19:2096973-2096995 CTGACGGCGGCGCTGGCCCACGG + Exonic
1161925065 19:7293923-7293945 GAGCGCGCGGCGCTGGCCCGCGG + Exonic
1162033078 19:7925685-7925707 CCGCCCGCGCCTCGGTCCCCGGG + Intronic
1162100167 19:8334470-8334492 CCGACCCCGTCGCTGGGCCCTGG - Intronic
1162345261 19:10114896-10114918 CCACCCACAGCGCTGGCCACAGG + Exonic
1162412309 19:10513956-10513978 CAGGCAGCGGCGCAGGCCCCCGG + Exonic
1162733733 19:12734355-12734377 CGGCCGCCGCCGCTGGCCCCGGG - Exonic
1162769219 19:12938879-12938901 TCGCCCGCGGCTCTAGTCCCGGG - Intronic
1163441612 19:17324836-17324858 CCGCCCGCCCCGTTGGACCCAGG + Exonic
1163517801 19:17775365-17775387 CCGCCCCCCGCCCTGCCCCCAGG - Intronic
1163612459 19:18308537-18308559 CTGCCTGCAGCGCTGGCCTCTGG - Intronic
1165073118 19:33267082-33267104 CCTCCCCCGGCGCTGGCAGCTGG + Intergenic
1166303779 19:41926573-41926595 CCTCCCGTGGCTCTGGCCCTGGG + Intronic
1166383710 19:42369009-42369031 CCGCAGGCGGCGCTGGGGCCAGG + Intronic
1166857884 19:45792392-45792414 ACGCCCGCGGGGCTGGGCTCGGG - Exonic
1166996445 19:46721875-46721897 CCTCCCCCAGCCCTGGCCCCCGG + Intronic
1167261569 19:48461855-48461877 GCGACCGCGGCGCCGGCCCACGG - Exonic
1167456293 19:49597934-49597956 CCGGCCTCGGCCCCGGCCCCGGG - Exonic
1167534251 19:50039471-50039493 CGGCACGCTGCGCTGGCCCAAGG - Intronic
1167660602 19:50793921-50793943 CAGCCCCAGGCGCTGGACCCGGG - Exonic
1168257214 19:55173580-55173602 CCGCCGGCGGGGCTGGCCTGCGG - Exonic
1168414590 19:56160226-56160248 CCGCCCTTGGTGCTGCCCCCGGG + Exonic
924962224 2:45812-45834 CCACCCGCGGCTCTGGCCCAGGG + Exonic
925161114 2:1685140-1685162 CTGCCTGGGGAGCTGGCCCCGGG - Intronic
925928321 2:8685809-8685831 CCGCTGGCGACGTTGGCCCCGGG + Intergenic
927215850 2:20667441-20667463 CGGCGCGCGGCGCGGGCCCGGGG - Exonic
927225978 2:20766926-20766948 CCGCCCAGGGCTCTGTCCCCAGG + Intronic
927472114 2:23384921-23384943 CCGCCCCCCGCGGTGGCCCCCGG - Intergenic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
927811871 2:26184992-26185014 CTGCCCGCGCCGCGCGCCCCCGG + Exonic
928599205 2:32886829-32886851 CGGCCGGTGCCGCTGGCCCCAGG - Intergenic
929242306 2:39665755-39665777 CCGCCCCCGGCCCGGCCCCCGGG - Intronic
930177415 2:48314863-48314885 CAGCCCGCGGCGCAGCTCCCGGG + Intronic
931106960 2:59067027-59067049 TGGCCGGCGCCGCTGGCCCCGGG + Intergenic
932331490 2:70900648-70900670 CCGCCCGGCGCGCGGGGCCCCGG - Exonic
932621771 2:73269085-73269107 CCGGCCCCGGCCCTTGCCCCGGG - Exonic
932983484 2:76698385-76698407 CAGCCAGCGGAGCCGGCCCCGGG - Intergenic
933666971 2:84971582-84971604 GGGCCCGAGGCGCTGGACCCGGG + Intronic
935595356 2:104873506-104873528 GCGCGCGCGGGGCTGGCCACAGG - Intergenic
935775103 2:106466216-106466238 CCGCCCGCAGCGGTCCCCCCAGG + Intronic
935904966 2:107829680-107829702 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936126743 2:109794752-109794774 CCGCCCGCCGCGGTCCCCCCAGG - Intronic
936217954 2:110576734-110576756 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
936279123 2:111122571-111122593 CTCCCCGCGCCGCTGGCGCCGGG - Intronic
936427291 2:112432808-112432830 CCGCCCGCCGCGGTCCCCCCAGG + Intronic
937360724 2:121228033-121228055 CCAGCCGCGGAGCCGGCCCCTGG - Intronic
938727295 2:134120151-134120173 GCTCCCGCGGCGGCGGCCCCGGG + Intronic
940774993 2:157876026-157876048 CGGCCAGCCGCGCCGGCCCCAGG - Intergenic
941808583 2:169734051-169734073 CGGGACGCGGCGCTGGCCCGCGG - Exonic
942314064 2:174682485-174682507 CAGCCCGAGGCGCGGGACCCAGG + Intronic
943222826 2:185132698-185132720 CGGCCTGCGCCGCTGGCCTCGGG + Intergenic
945251259 2:207768204-207768226 CCGCCAGGGGCGCCGGCCTCGGG - Exonic
945993038 2:216412598-216412620 TCGCCCCCGGCCCTGACCCCAGG - Exonic
946929128 2:224655397-224655419 CGGCCAGTGCCGCTGGCCCCAGG + Intergenic
947171900 2:227320726-227320748 CGGCCAGCACCGCTGGCCCCAGG + Intergenic
948402202 2:237692267-237692289 CGGCTCGCGGCGCTGGGCTCGGG - Intronic
948468618 2:238163877-238163899 CTGGCCGCGCCCCTGGCCCCGGG + Exonic
948727581 2:239944359-239944381 CAGCCTGCGGCGCTGGCCCTGGG - Intronic
948903499 2:240967409-240967431 CCCCACGCGGCTCTGGGCCCGGG - Intronic
1168769759 20:407957-407979 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1169065678 20:2693159-2693181 CCGCCCGCGGCGCCAGCGCGGGG - Intronic
1169367163 20:5001204-5001226 CCGCCGGCCACCCTGGCCCCGGG - Intronic
1171487786 20:25496561-25496583 ACACCCGCAGCTCTGGCCCCTGG + Intronic
1172026414 20:31951843-31951865 CCCTCCGCGGCGCTGGGGCCTGG - Intronic
1172966004 20:38835857-38835879 CCCCGCGCTGCCCTGGCCCCCGG + Exonic
1173822743 20:46029593-46029615 CGGCCCGCAGCTCTGCCCCCGGG - Intronic
1173831497 20:46091950-46091972 CGGCCCGCCCTGCTGGCCCCAGG + Intergenic
1173939136 20:46894995-46895017 CCGCCAGCGGCGCCCACCCCAGG + Intronic
1174305897 20:49614099-49614121 CCGCCCCCGACCCTGGCACCTGG - Intergenic
1175888084 20:62303370-62303392 CCGCACTCGGCGCTGGGCCGGGG - Intronic
1175944339 20:62551692-62551714 CCTCCCGCGGCGCTGATGCCGGG + Intronic
1175997661 20:62818697-62818719 CCTCCCGCCCCGCTGGCTCCAGG - Intronic
1176015574 20:62929466-62929488 CCGCCCGGGTCGCGGGCCCGCGG - Intronic
1176132510 20:63502310-63502332 CTGCCTGCGACGGTGGCCCCGGG - Intergenic
1176389252 21:6155139-6155161 CTGCCAGAGGCGCTGGGCCCTGG + Intergenic
1177188113 21:17819672-17819694 CCGCCTGCGGCCCCCGCCCCGGG - Intergenic
1177775520 21:25562151-25562173 CTGCAGGCGGCGCTGGGCCCGGG - Intergenic
1178457742 21:32771460-32771482 CCGCCTTCCGCGCTGACCCCGGG - Exonic
1178872084 21:36385508-36385530 CCGCCCTCGGCGAGGGCCTCTGG - Intronic
1178901305 21:36601210-36601232 CAGCCCCCAGCGCTGGCCTCAGG + Intergenic
1179466826 21:41581431-41581453 CCGCCCGCCGCCCAGGACCCAGG + Intergenic
1179626887 21:42653920-42653942 CCGGCCCCGGCGCTGTCACCCGG - Intronic
1179734219 21:43383108-43383130 CTGCCAGAGGCGCTGGGCCCTGG - Intergenic
1180077031 21:45468174-45468196 CAGGCCGCGTCGGTGGCCCCTGG + Intronic
1180095891 21:45555223-45555245 CCGCCCCCTGCGCCGCCCCCCGG - Intergenic
1180216230 21:46325001-46325023 ACCCACGCGGCGCTGGCGCCGGG + Intronic
1180475410 22:15700882-15700904 CAGCCCCCTGCTCTGGCCCCTGG + Intronic
1180559172 22:16601795-16601817 CCGCCCGCGGCCCCTCCCCCGGG - Intergenic
1180960721 22:19761135-19761157 GCGGCCGCGCAGCTGGCCCCGGG - Exonic
1180962035 22:19766499-19766521 CCGCCGGCGCCGCCGGCCCCGGG - Exonic
1181116110 22:20633352-20633374 CTGCCCGTGGCCCTGGCCCCTGG + Intergenic
1183744793 22:39686148-39686170 CCGCCCCCGCCGCCAGCCCCCGG + Exonic
1183903316 22:41022066-41022088 CCCCCAGCGGCGCGCGCCCCCGG - Intergenic
1184663447 22:45976050-45976072 CCGCCCGGGGCCCTGGGCCCTGG - Intronic
1185335859 22:50270549-50270571 CCGCCCTCGGCGCCCCCCCCGGG - Intronic
1185409539 22:50674651-50674673 ACGACCACGGCGCTGGCCCCGGG - Intergenic
951551893 3:23882797-23882819 CGGCCGGCGCCACTGGCCCCAGG - Intronic
953618211 3:44510709-44510731 CCGCCAGCGGCCCTGGGCCCAGG - Intergenic
953657078 3:44862267-44862289 CCGCCCGCGGCCCGGGGCCCCGG - Intronic
954076882 3:48188096-48188118 CCGGCCGCGCCGCTTGCCCGCGG - Exonic
954230576 3:49213702-49213724 CAGCCTGCGCCGCTGGCCCCAGG - Intronic
954388978 3:50259142-50259164 GCCCCAGCGGCCCTGGCCCCAGG + Exonic
958034034 3:88149606-88149628 CCGCCCGCTGGCCGGGCCCCCGG - Intronic
960047482 3:113211955-113211977 GCGCCCACCACGCTGGCCCCCGG + Exonic
960120838 3:113947796-113947818 TGGCCCGCGGCCCTGGCGCCGGG - Intergenic
961794745 3:129401534-129401556 CCGCTGGCTGCACTGGCCCCTGG + Exonic
962177255 3:133167653-133167675 CGGCCGGTGGCACTGGCCCCGGG - Intronic
964438048 3:156674717-156674739 CCGCCCTCGGCGCTGATCTCCGG + Intronic
964852062 3:161105346-161105368 CCGGCCGCGGCCCTGGCGCGTGG - Exonic
966108221 3:176362484-176362506 CCGCCGGCGGCGCGGGCCCCGGG - Intergenic
966919332 3:184601931-184601953 CCGGCGGCGGAGCCGGCCCCCGG - Intronic
967845490 3:194039411-194039433 CCGCCCTGGGAGCAGGCCCCAGG - Intergenic
968506443 4:973353-973375 CCGGCCCCGGCCCCGGCCCCGGG + Exonic
968542018 4:1172614-1172636 CGGCCCGGGGCGCCGGCCTCGGG - Exonic
968674977 4:1872043-1872065 CTGGCCCCGGCGCCGGCCCCGGG - Intronic
968756051 4:2417244-2417266 CTCCCCGCTGCGCCGGCCCCAGG + Intronic
968835923 4:2964046-2964068 CCGCCGGCGGCGGCGGCGCCAGG + Exonic
969256847 4:6008137-6008159 CTGCCCGCGGAGCTGGCGCTCGG + Intergenic
969688266 4:8689076-8689098 CTGCCTCCAGCGCTGGCCCCTGG - Intergenic
970008107 4:11429171-11429193 CCACCCGGTGCGGTGGCCCCTGG + Exonic
970574590 4:17414548-17414570 CTGCCGGCACCGCTGGCCCCGGG - Intergenic
971209141 4:24599377-24599399 CAGCTGGCGTCGCTGGCCCCGGG - Intergenic
971352028 4:25863199-25863221 CCGCCCGGGTCGCTGGGCCCCGG + Intronic
973048560 4:45567152-45567174 CAGCCGGCCCCGCTGGCCCCAGG + Intergenic
976303368 4:83536129-83536151 TCGCCGGCGGAGCTGGCACCGGG - Intronic
978576950 4:110197771-110197793 CCGCCCGCCGCCCTTGGCCCTGG - Intronic
979189494 4:117838968-117838990 CCGCCCGCCTCGGTGGCCCAAGG - Intergenic
980115206 4:128672762-128672784 CAGCCCGCCCCGCTGCCCCCGGG + Intergenic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
982679083 4:158408165-158408187 CCGGCCGCCCCGCTGGCCCCGGG + Intronic
983493166 4:168412460-168412482 CCACCAGCGGCCCTGGCCCATGG - Intronic
984548412 4:181133245-181133267 CCTCCCACTGCGCTGTCCCCTGG + Intergenic
984638940 4:182143010-182143032 CCCACCGCAGCGCTGGCTCCCGG - Intergenic
987084486 5:14456130-14456152 CAGCCAGCGCCACTGGCCCCAGG - Intronic
987340671 5:16936356-16936378 CCGCTCGCGGCCCCGCCCCCAGG + Intergenic
991063636 5:62403728-62403750 CCGCCCGCGGCGGCGGCCGATGG + Exonic
991330238 5:65485692-65485714 CCGCCGGCCCCACTGGCCCCGGG - Intergenic
995052731 5:107724760-107724782 CTGCCCGCAGCCCCGGCCCCCGG + Intergenic
995596463 5:113753379-113753401 CAGCCAGCGCTGCTGGCCCCGGG - Intergenic
995724683 5:115170282-115170304 CCGGCTGCAGCCCTGGCCCCTGG + Intronic
997470627 5:134115120-134115142 CGGGCCCCGGCGCCGGCCCCCGG - Exonic
1001382265 5:171312401-171312423 CCCGCCCCGGCGCTGGCCCGCGG - Intergenic
1001843550 5:174901618-174901640 CAGCCGGCGCCGCTGGCCCTGGG + Intergenic
1002082164 5:176743579-176743601 GCACCCCCGGGGCTGGCCCCTGG + Intergenic
1002742248 5:181442489-181442511 CCCCACGCAGCGCTAGCCCCTGG + Intergenic
1002925736 6:1604890-1604912 CCGGCCCCGGCCCAGGCCCCCGG + Intergenic
1003087123 6:3068923-3068945 CCGCCCGCCGCGCGCACCCCGGG - Intronic
1003325329 6:5086095-5086117 TCGGCCGCGGCGCTCGGCCCCGG - Exonic
1004248447 6:14002527-14002549 CGGCCAGCCCCGCTGGCCCCAGG + Intergenic
1004861388 6:19807228-19807250 CCACCAGCGGTGCCGGCCCCGGG - Intergenic
1005596188 6:27381197-27381219 CTTCCCGCGGCGCAGGCCTCGGG - Intronic
1006472655 6:34237328-34237350 CCGCCGCCGCCGCGGGCCCCGGG - Intronic
1006903185 6:37516138-37516160 CTGCCTGGGGCGCTGGCCTCTGG - Intergenic
1007902290 6:45423022-45423044 CTGCCCACGGGGCTGGGCCCCGG + Intronic
1008230826 6:48983652-48983674 CCACCAGCCCCGCTGGCCCCGGG - Intergenic
1008381874 6:50845972-50845994 CCACCCGGGGCGCCGGCTCCTGG + Exonic
1008430474 6:51410713-51410735 GCGCCCGCGGAGCTCGCACCAGG - Intergenic
1012549717 6:100455621-100455643 ACGCCGGCGACGCTGGCCCTTGG + Intronic
1014844462 6:126258314-126258336 CAGACGGCGGCCCTGGCCCCAGG - Intergenic
1016448321 6:144155329-144155351 CCGCCCCTGCCGCTGCCCCCAGG - Intronic
1017039934 6:150300148-150300170 CCGCATGCTGCCCTGGCCCCTGG + Intergenic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1018440489 6:163807665-163807687 CCGCCCGAGGCTCTGGCCCCAGG + Intergenic
1018628727 6:165804788-165804810 CCGCCCGCGGCCCGGCCCCGGGG - Intronic
1019247384 6:170718227-170718249 CCCCACGCAGCGCTAGCCCCTGG + Intergenic
1019597131 7:1863373-1863395 ACGGCCGTGCCGCTGGCCCCGGG - Intronic
1019764997 7:2843760-2843782 CCGCCCGCGGCGGCGGACCACGG + Intronic
1020278290 7:6637467-6637489 CCGCCCGCGCCGCCGCCCACCGG - Intronic
1023232491 7:38049855-38049877 CGGCCAGTGCCGCTGGCCCCAGG + Intergenic
1026098355 7:67364784-67364806 CAGCAGGCGCCGCTGGCCCCAGG - Intergenic
1026771889 7:73207413-73207435 CCGCAAGTGGCGCTGTCCCCGGG - Intergenic
1027012757 7:74760809-74760831 CCGCAAGTGGCGCTGTCCCCGGG - Intergenic
1027075283 7:75185244-75185266 CCGCAAGTGGCGCTGTCCCCGGG + Intergenic
1027213031 7:76165698-76165720 CCCCCCGTGGCCATGGCCCCAGG + Intergenic
1028796407 7:94908117-94908139 CCGCCCGCGGCGCTCCCGCTCGG + Intronic
1029065356 7:97843126-97843148 CGGCTGGCGCCGCTGGCCCCGGG - Intergenic
1029139830 7:98401480-98401502 CCTCGCGTGGTGCTGGCCCCGGG + Intergenic
1029604499 7:101590433-101590455 CCGCCTGCAGGGCTGGCACCAGG - Intergenic
1030048952 7:105521732-105521754 CCCCGCGCGGCGCTGTCCCCCGG - Intronic
1030138636 7:106284356-106284378 CAGCCCGGCGCGCTCGCCCCTGG - Intronic
1031513322 7:122674089-122674111 CAGCCAGCACCGCTGGCCCCGGG - Intronic
1032083064 7:128869647-128869669 CCGCCGGCGGCGCTGCCGCCTGG + Intronic
1032174413 7:129611928-129611950 CCGCCCCCGGCTCTGGGCCTGGG + Intronic
1033199774 7:139359167-139359189 GAGCCAGCGGCGCTGGCCGCAGG - Intronic
1033253174 7:139777773-139777795 CCTCCCCCGGCGCCGGCCACGGG - Intronic
1034455408 7:151167499-151167521 CCGCCCCCGCCGTTGCCCCCAGG + Exonic
1035266378 7:157692241-157692263 CTGCCCGCGGCGCCCGCTCCCGG + Intronic
1035325404 7:158062671-158062693 CAGCCAGCGCTGCTGGCCCCAGG + Intronic
1035500753 8:89709-89731 CCCCACGCAGCGCTAGCCCCTGG - Intergenic
1036554660 8:9848016-9848038 CGGCCGGCCGCGCTGGCCCCGGG - Intergenic
1036950123 8:13132684-13132706 CCGCCTGGTGCGCTGGCCCGCGG + Intronic
1037273786 8:17156668-17156690 CCGCCCGCGGGCCTGGCTCCGGG - Exonic
1037450682 8:19013658-19013680 GAGCACGCGGCGCTGGCCGCCGG - Exonic
1037826836 8:22164960-22164982 CCGCCCGGGCCGCGGGCCGCGGG - Exonic
1037855276 8:22367196-22367218 CGGCCCGCCCCGCTCGCCCCGGG - Intergenic
1037903831 8:22703774-22703796 CCGCCCGCGGCCCGGGCGGCGGG - Intergenic
1038761178 8:30384973-30384995 CAGCCCGCGGCGCCCGCCCGAGG + Exonic
1038828791 8:31034060-31034082 AGGCCCGCGGAGCAGGCCCCTGG + Intronic
1040701770 8:50074961-50074983 CTGCCGGCGCCACTGGCCCCAGG + Intronic
1041167250 8:55102305-55102327 CCGCCCGCCGGGCTGGGCGCTGG - Intergenic
1041690297 8:60680116-60680138 CCCCCACCGGCGCTGACCCCCGG - Intronic
1042267624 8:66925327-66925349 CCGCCCGCTCCGCTGCGCCCGGG + Intergenic
1044821899 8:96160773-96160795 CCGCCCGAGGAGCCGGGCCCCGG - Exonic
1044963906 8:97557014-97557036 CCGCCAGCGCTGCTGGCCGCGGG + Intergenic
1045432055 8:102123818-102123840 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1046654033 8:116874144-116874166 GCGCCCGCGGTGCCAGCCCCGGG - Intronic
1046770350 8:118111653-118111675 GCGCTCGCGGGGCCGGCCCCCGG + Exonic
1047225808 8:122954692-122954714 CAGCCAGCGGTGCTGCCCCCTGG - Intronic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1047961615 8:130015936-130015958 CCGGGAGCAGCGCTGGCCCCCGG - Intronic
1048186896 8:132249917-132249939 CGGCCGGTGCCGCTGGCCCCAGG - Intronic
1049172953 8:141173397-141173419 CAGCACGCGGCGCAGGCACCAGG - Intronic
1049343650 8:142127175-142127197 GTGCCCCAGGCGCTGGCCCCAGG + Intergenic
1049424819 8:142533247-142533269 CCGCCCCCGCCCCTGCCCCCAGG - Intronic
1049697438 8:143990879-143990901 CCGGCAGCGGCGCAGGCCTCCGG + Intronic
1050090942 9:2016242-2016264 GCGCCCGGGGCGCAGCCCCCTGG - Intronic
1051170605 9:14315458-14315480 CCGCCGGCGCCCCGGGCCCCGGG - Intronic
1052014836 9:23452133-23452155 CGGCCAGTGCCGCTGGCCCCGGG + Intergenic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1055090982 9:72364788-72364810 CGGCCCGCGGCGGCGGCACCAGG - Intronic
1055102579 9:72480462-72480484 CAGCCGGCCCCGCTGGCCCCGGG - Intergenic
1055785205 9:79863731-79863753 CCGGCCCCGGCCCCGGCCCCGGG + Intergenic
1056677254 9:88686176-88686198 CCGCCGGCGCCACTAGCCCCGGG - Intergenic
1057619036 9:96619158-96619180 CCGCACCCGGCGCGGGGCCCTGG - Intronic
1057773221 9:97984644-97984666 CCGCCCTCGGCGCTGGCTGGCGG + Intronic
1058365171 9:104200694-104200716 CAGCCAGCACCGCTGGCCCCAGG + Intergenic
1059268315 9:113056552-113056574 CTCACCGCGGCGCTGGCCTCGGG + Exonic
1061015943 9:127980833-127980855 GGGCCCGCGGCGCGGGTCCCAGG - Intergenic
1061263142 9:129490898-129490920 CCGCCCCAGGCCCTGGCCTCTGG + Intergenic
1061793471 9:133070879-133070901 CCGCCCTCTGAGCTGGCCCTGGG - Intronic
1061796080 9:133086678-133086700 CCGCCCTCTGAGCTGGCCCTGGG - Intronic
1062279253 9:135744686-135744708 CCGTCAGCGGCGCTGGCCCATGG - Intronic
1062387116 9:136317062-136317084 CTGCCAGCCGCGATGGCCCCGGG - Intergenic
1062467289 9:136686931-136686953 CCACCCCCCGCCCTGGCCCCGGG - Intronic
1062478461 9:136740996-136741018 CCGCCCACAGCCCTGACCCCTGG + Intronic
1062493666 9:136821658-136821680 CCTCCCGCCGCGCTGGGGCCTGG + Intronic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062596435 9:137301978-137302000 GCGGCTGCGGCGCGGGCCCCCGG + Exonic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1203608157 Un_KI270748v1:73704-73726 CCCCACGCAGCGCTAGCCCCTGG + Intergenic
1189001941 X:36957510-36957532 CCTACCGCGGCCCTGGCCCGCGG - Intergenic
1189398863 X:40647027-40647049 CCGGCCGGGCCGCTGGCCCGTGG - Exonic
1190984460 X:55488606-55488628 CCGCCCTCGGCCCCAGCCCCGGG - Exonic
1192495940 X:71616716-71616738 CCGCAGGCGCCGCTGGCCCCTGG + Exonic
1194121220 X:89965908-89965930 CCGCCAGCCCTGCTGGCCCCGGG - Intergenic
1196860878 X:120026047-120026069 CGGCCAGCGCCACTGGCCCCGGG - Intergenic
1200100786 X:153688420-153688442 CCGCCCGCCGCCCCGTCCCCCGG + Exonic
1200222534 X:154398181-154398203 CCGCCCGCGGCCCTGGTACCCGG + Intronic
1200474077 Y:3623359-3623381 CCGCCAGCCCTGCTGGCCCCAGG - Intergenic
1201495704 Y:14590045-14590067 CGGCCAGCGCTGCTGGCCCCGGG - Intronic