ID: 1066182080

View in Genome Browser
Species Human (GRCh38)
Location 10:32972669-32972691
Sequence GATACTTGACATTGACAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066182080_1066182086 26 Left 1066182080 10:32972669-32972691 CCACTTTGTCAATGTCAAGTATC 0: 1
1: 0
2: 3
3: 7
4: 173
Right 1066182086 10:32972718-32972740 GTTCTTCCGCTTCACAGTGGAGG No data
1066182080_1066182083 -7 Left 1066182080 10:32972669-32972691 CCACTTTGTCAATGTCAAGTATC 0: 1
1: 0
2: 3
3: 7
4: 173
Right 1066182083 10:32972685-32972707 AAGTATCTGCAGCGAGGGTGAGG No data
1066182080_1066182085 23 Left 1066182080 10:32972669-32972691 CCACTTTGTCAATGTCAAGTATC 0: 1
1: 0
2: 3
3: 7
4: 173
Right 1066182085 10:32972715-32972737 TCAGTTCTTCCGCTTCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066182080 Original CRISPR GATACTTGACATTGACAAAG TGG (reversed) Intronic
900281960 1:1875672-1875694 GATAATTTACATAGAAAAAGGGG - Intronic
905842431 1:41193881-41193903 GATACTTAACATCCATAAAGGGG + Intronic
906203288 1:43973560-43973582 GATACCTGACAAGGACTAAGAGG + Intergenic
909007460 1:70293825-70293847 GATAATTTACATTTACTAAGTGG - Intronic
909205954 1:72758161-72758183 GACACTTGACTTTGAAGAAGTGG - Intergenic
909504356 1:76371379-76371401 GACACATGACATTGAATAAGGGG + Intronic
909567742 1:77073745-77073767 GATTCTTAACAATTACAAAGGGG - Intergenic
909849668 1:80444864-80444886 GATGCAAGACATTGAAAAAGGGG - Intergenic
910680313 1:89856929-89856951 TATAATTGACATTCTCAAAGAGG - Intronic
912252543 1:108026363-108026385 GATACTAGAAAGTGAGAAAGTGG + Intergenic
916519983 1:165554945-165554967 CCTATTTGACATTTACAAAGAGG + Intronic
916592263 1:166203943-166203965 GGTACTACACATTGATAAAGGGG - Intergenic
919149131 1:193672847-193672869 AATACTTGATATTTACACAGTGG + Intergenic
920620138 1:207537465-207537487 GATGCCTGACATTTTCAAAGGGG - Intronic
920621920 1:207556020-207556042 GATGCCTGACATTTTCAAAGGGG - Intronic
920623546 1:207573115-207573137 GATGCCTGACATTTTCAAAGGGG - Intronic
921806366 1:219459918-219459940 GATACTTGACAATGGAATAGAGG + Intergenic
921838044 1:219798362-219798384 GATACTCATCATTGAAAAAGAGG + Intronic
922860268 1:228810483-228810505 CACAGTTGACAATGACAAAGAGG + Intergenic
923836446 1:237616228-237616250 AATACATGACAGTGTCAAAGAGG - Intronic
924573198 1:245256756-245256778 GAGACTTCAGACTGACAAAGCGG + Intronic
1062998579 10:1892158-1892180 GGTACTTGACAGTGACATATTGG - Intergenic
1063097008 10:2917389-2917411 GAAACTTGCCATTGGCGAAGTGG - Intergenic
1066182080 10:32972669-32972691 GATACTTGACATTGACAAAGTGG - Intronic
1068424751 10:56845570-56845592 TGTGGTTGACATTGACAAAGAGG - Intergenic
1072793196 10:98334177-98334199 AATACTTGTCAATCACAAAGAGG - Intergenic
1074369054 10:112884388-112884410 GATACTTATCAGTTACAAAGGGG - Intergenic
1076277854 10:129219937-129219959 TAGATTTGACATTGGCAAAGAGG - Intergenic
1086056043 11:82647687-82647709 GATTCTTCACATTGGCAAATAGG + Intergenic
1086338116 11:85819932-85819954 GATGCTGGACATTGAGAGAGAGG - Intergenic
1087700177 11:101428454-101428476 GAGACTTGAAAATGACAAAGAGG - Intergenic
1088712613 11:112522101-112522123 GATATTTGACATTTAAAAAAAGG + Intergenic
1091883104 12:3995602-3995624 GCTCCTTGACAGTGAGAAAGAGG + Intergenic
1092966666 12:13650329-13650351 GAGAATTTACATTGACAGAGGGG - Intronic
1095843282 12:46718140-46718162 GATACTTCACAGTCACACAGGGG - Intergenic
1097769533 12:63566365-63566387 GATAATTCACATTGACAGAATGG + Intronic
1098984400 12:76995970-76995992 GATATTTGATATTTACAAACTGG - Intergenic
1100542848 12:95574172-95574194 GATCATTGACATAGAAAAAGGGG - Intergenic
1104654764 12:130566027-130566049 GGAACTTGTCATTGATAAAGAGG + Intronic
1107615734 13:42165370-42165392 GATACTTTACATTGACCAAGTGG - Exonic
1109185093 13:59258967-59258989 GACATTTGATATGGACAAAGAGG + Intergenic
1109602402 13:64649426-64649448 GATACTTGAAAATGTGAAAGTGG + Intergenic
1109725516 13:66335886-66335908 CTTACTTGACATTGACAATACGG - Intronic
1110902653 13:80842734-80842756 TATACTTAACATTTACTAAGGGG - Intergenic
1113095370 13:106658107-106658129 TATACATGACAGTGAAAAAGGGG + Intergenic
1118169495 14:63373026-63373048 GATACTTCACAATGAGAAACAGG + Exonic
1118437321 14:65783688-65783710 GACACTTGACATTTACAGATAGG - Intergenic
1119960777 14:78854100-78854122 GATGCTTGACTTTGGCTAAGTGG - Intronic
1123955627 15:25331432-25331454 GAGAGTTGACATTGAGAAAAGGG + Intergenic
1124208666 15:27744331-27744353 GGAACTTGACATTGACAATAAGG + Intergenic
1127401251 15:58588249-58588271 GACACTTGGCACTGACAATGGGG - Intergenic
1127536010 15:59890515-59890537 AAGGCTTGACATTGACAGAGAGG - Intergenic
1127578864 15:60318368-60318390 GATACTTGACATGTGCAAATGGG - Intergenic
1128643885 15:69360762-69360784 GAAATTTGACATCAACAAAGGGG - Intronic
1128765328 15:70247833-70247855 GAGACCTGACATTTACACAGAGG - Intergenic
1132283947 15:100645737-100645759 GATGCTAAACATTTACAAAGTGG + Intronic
1133599249 16:7323064-7323086 GATGGTTGAGATTGACTAAGGGG + Intronic
1133644071 16:7746517-7746539 GCTAAGTGACATTGTCAAAGTGG - Intergenic
1136639705 16:31553155-31553177 GAGACAAGAGATTGACAAAGAGG - Intergenic
1136665058 16:31803343-31803365 GAGACAAGAGATTGACAAAGAGG + Intergenic
1137024158 16:35456514-35456536 GATGCTGGACATTGCCATAGAGG + Intergenic
1139271479 16:65687554-65687576 GATACTCGACATTGAGTCAGTGG + Intergenic
1140240740 16:73197741-73197763 CTTACTTGACATAGACTAAGTGG + Intergenic
1146636140 17:34506763-34506785 GAGACTAGAAATTGACAAAATGG + Intergenic
1147297333 17:39494549-39494571 GAGACTAGACAATGAGAAAGAGG + Exonic
1147477150 17:40723142-40723164 CCTACTTGACATTGACACTGGGG + Intergenic
1152000373 17:77641511-77641533 GATACTTGAAATGGACCAAAGGG + Intergenic
1155947051 18:31866064-31866086 GATTATTAACATTGAGAAAGTGG - Intronic
1156134241 18:34017255-34017277 GATACTTAATTTTGAGAAAGAGG - Intronic
1159037059 18:63287356-63287378 GATAAATGGCATTGACGAAGAGG + Intronic
1159188904 18:65016701-65016723 AGTACTTGACATAGATAAAGGGG + Intergenic
1163200168 19:15761028-15761050 GAACCTTGGAATTGACAAAGAGG + Intergenic
1163809635 19:19422643-19422665 GATACTATACATTGTCAAGGAGG + Intronic
1167777469 19:51569517-51569539 GTTACTTGACATTATTAAAGAGG + Intergenic
924997918 2:380919-380941 CATACTTGAAATTCACTAAGAGG + Intergenic
927108613 2:19848397-19848419 GGAACTTGACATAGCCAAAGTGG + Intergenic
927314003 2:21661178-21661200 CATTCTTGACACTGACAATGAGG - Intergenic
928318208 2:30262407-30262429 GATCCTAGACATTAACAAAATGG - Intronic
929952180 2:46421255-46421277 GATAATAGATAATGACAAAGTGG + Intergenic
931278024 2:60761549-60761571 GATCCTTAACAGTGCCAAAGAGG - Intronic
933314574 2:80700680-80700702 GATATTTGAAACTCACAAAGAGG - Intergenic
933420412 2:82038357-82038379 GATACCTGAAAATGTCAAAGTGG - Intergenic
937165480 2:119811326-119811348 GCTATTTCACATTGAAAAAGGGG + Intronic
937995692 2:127692905-127692927 GTTACTTGTGATTTACAAAGAGG + Intergenic
938812596 2:134867363-134867385 GACACTTGGAATTAACAAAGGGG - Intronic
939222753 2:139324096-139324118 GAAGATTGACATTGGCAAAGAGG - Intergenic
940779607 2:157918887-157918909 GGAACTTTTCATTGACAAAGAGG - Intronic
941058109 2:160811763-160811785 GATAGTTGAAATTGACATGGTGG - Intergenic
942707446 2:178792741-178792763 GATATTTGAGAATGGCAAAGAGG - Intronic
943862462 2:192885834-192885856 GTTACTTGCCTTTGACATAGAGG + Intergenic
945211808 2:207390948-207390970 GATGATTGACTTTGACAAAGTGG + Intergenic
945354332 2:208820066-208820088 GATACTTGACATTGAAATAGAGG - Intronic
1169774637 20:9239255-9239277 GATACTTGACAACGTAAAAGAGG - Intronic
1169963804 20:11192727-11192749 GATACTTGACAGTGGGACAGTGG - Intergenic
1170479389 20:16750447-16750469 TATACTTGAAATTTACTAAGAGG - Intronic
1174643329 20:52064062-52064084 GATACTTATCAAAGACAAAGGGG + Intronic
1177707334 21:24724278-24724300 AATATGTGACATTGGCAAAGTGG - Intergenic
1178112661 21:29384654-29384676 GAAATTTGACATTTATAAAGGGG - Intronic
1183835285 22:40447619-40447641 GAACCTTGACACTGACAAAAAGG + Intronic
949480396 3:4488828-4488850 CCTACTTGACATGGAAAAAGTGG - Intergenic
949586642 3:5446342-5446364 GATATTTTACAATGACAAAAAGG - Intergenic
950893331 3:16424955-16424977 GTTACTTCTGATTGACAAAGAGG + Intronic
951302396 3:21014225-21014247 GATAATTGACAATGATCAAGTGG - Intergenic
952922798 3:38297822-38297844 GATACTTATCATTTACAAAGGGG - Intronic
953479350 3:43236730-43236752 GATACTGGAGAGTGACAAACAGG - Intergenic
956362535 3:68464414-68464436 GATACTTGGAATGGACAAGGAGG + Intronic
956547124 3:70417195-70417217 GATGATTGACATTGGTAAAGGGG - Intergenic
956806338 3:72816882-72816904 GACACTTCACATTGGCAAGGGGG - Intronic
957497830 3:81013091-81013113 GAAACTTGCCTTTGAAAAAGGGG - Intergenic
958119494 3:89265838-89265860 GAAACTTGACATGGAGGAAGAGG - Intronic
960461334 3:117939408-117939430 GATACTTCACATTGAGAATCAGG + Intergenic
960622713 3:119652403-119652425 AACACTTGACATTTGCAAAGAGG + Intronic
963031081 3:140977256-140977278 GATACTTAAGTATGACAAAGAGG - Intronic
963558770 3:146833309-146833331 GATACATGCCACTGAAAAAGAGG + Intergenic
965112538 3:164446392-164446414 GACAATTGAAAATGACAAAGAGG - Intergenic
965819729 3:172673031-172673053 GATACTGGACATTGAAGAAAAGG + Intronic
970325355 4:14918401-14918423 GATTTTTGAAAATGACAAAGAGG + Intergenic
973104296 4:46314408-46314430 GATACTTAAAATTTACAAACAGG + Intronic
977501498 4:97844816-97844838 AATACTTGACATTGACCCACAGG + Intronic
978237389 4:106475319-106475341 GACACTTGACTTTGAGGAAGTGG + Intergenic
987926521 5:24349516-24349538 GAAACTTGACATTAGCAAAGAGG + Intergenic
993904712 5:93610113-93610135 TATACTTGACATTGACAAATGGG + Intergenic
994688929 5:102992221-102992243 GATAAATGACATCTACAAAGGGG + Intronic
995591710 5:113706533-113706555 GATACTTGAAAATGTCGAAGTGG - Intergenic
998395435 5:141814910-141814932 GCTGCTTCACATTGGCAAAGTGG + Intergenic
1000933736 5:167283345-167283367 GACACTTGGCAATGAAAAAGAGG - Intergenic
1001366830 5:171149919-171149941 GATACATTAAATTGACACAGAGG - Intronic
1002463750 5:179392038-179392060 GACACTTCACAATGACAAAATGG + Intergenic
1004043564 6:12006451-12006473 GTTACTTGCCATTGAAAGAGAGG + Intergenic
1006657124 6:35605246-35605268 GATTCTGAACATTGATAAAGAGG - Intronic
1008409962 6:51165569-51165591 GATTATTAACCTTGACAAAGTGG - Intergenic
1009699464 6:67157822-67157844 GTTAGTTGACATTGACAAATAGG - Intergenic
1010306586 6:74330956-74330978 CATACTTCACATTGACAAAAGGG - Intergenic
1010544273 6:77130659-77130681 GATACTGGAGATTACCAAAGGGG + Intergenic
1010601482 6:77833559-77833581 GAAAAGTGACATTGAAAAAGAGG + Intronic
1011524343 6:88247052-88247074 GAAACTTCACATTCAGAAAGAGG + Intergenic
1013507008 6:110810842-110810864 TATACAGGACATTTACAAAGTGG - Intronic
1015493483 6:133854981-133855003 GATACGGGACCTTGACAAATTGG + Intergenic
1017173272 6:151477810-151477832 GTTACTTGATATTGACAACTTGG - Intergenic
1018129224 6:160712606-160712628 GATAGTTCACATGGACAAAATGG + Intronic
1021472913 7:21026708-21026730 GATAGTTTTCATTAACAAAGAGG - Intergenic
1024496257 7:50049925-50049947 GTTACATGACTTTGACAAGGTGG + Intronic
1024516165 7:50259782-50259804 GACACTTCACAATGACAAAAGGG + Intergenic
1026230723 7:68481274-68481296 AATATTTAACATTGCCAAAGTGG - Intergenic
1027921466 7:84400569-84400591 GATACTTGAAAGTTACATAGAGG + Intronic
1028747623 7:94346000-94346022 GGAAATTGACATTTACAAAGTGG + Intergenic
1031028597 7:116710345-116710367 GATTATTGACATGTACAAAGAGG + Intronic
1031692124 7:124801830-124801852 GAAACTTGACATTTATAAATGGG + Intergenic
1031708019 7:125006698-125006720 GATACCTAACATTAACAGAGAGG - Intergenic
1032243709 7:130188643-130188665 GATCCTTGTCCTTGATAAAGTGG - Intronic
1033621489 7:143065737-143065759 TATACTTGACATTTGCTAAGAGG - Intergenic
1033862725 7:145647696-145647718 GATACTAAGCATTGAAAAAGAGG - Intergenic
1035933703 8:3812921-3812943 GATACCTGACGTTATCAAAGAGG - Intronic
1036392832 8:8339451-8339473 CAAACTTGACATTGACGGAGAGG - Intronic
1037714670 8:21386981-21387003 CAAACTTCACATTGCCAAAGGGG - Intergenic
1039356338 8:36820902-36820924 GAAGCCTGACATTGTCAAAGTGG + Intronic
1043570060 8:81592812-81592834 GATAGTTGACATTGTAGAAGAGG + Intergenic
1046259886 8:111754185-111754207 GATACTTTACAATTAAAAAGAGG - Intergenic
1047250195 8:123176320-123176342 AATACTTGATAATTACAAAGGGG - Intergenic
1047447463 8:124932181-124932203 GATACTTGCAAATGACTAAGTGG + Intergenic
1048137818 8:131763298-131763320 TAGAATTCACATTGACAAAGGGG + Intergenic
1049109266 8:140633614-140633636 CATACTTGTCATTGACAGCGGGG - Intronic
1051724106 9:20071066-20071088 GATACTTCACATGGCCAAAGAGG - Intergenic
1051850903 9:21506663-21506685 GGTACTTGAGAATGAAAAAGAGG - Intergenic
1052384350 9:27806811-27806833 GATGTTTGAGGTTGACAAAGGGG + Intergenic
1052570702 9:30218562-30218584 GAAACTTGAAATTGGCAAAAAGG - Intergenic
1052609266 9:30749866-30749888 AATACATGACATTTACAGAGTGG + Intergenic
1058801546 9:108549381-108549403 TTTACTTGACATTGGCAAATAGG - Intergenic
1059397077 9:114042108-114042130 CAGACTTTACATTCACAAAGGGG - Intronic
1059808047 9:117826116-117826138 GATAATAGACATTGATAAACAGG + Intergenic
1186238292 X:7538016-7538038 GATACATCACATTAACAAAATGG - Intergenic
1189586401 X:42466658-42466680 TATATGTGACATTGTCAAAGAGG + Intergenic
1191767763 X:64718637-64718659 GATACAAGACATTTAAAAAGAGG - Intergenic
1193150184 X:78116775-78116797 AACACTTCACATTGACAAAAAGG - Intronic
1193526444 X:82596215-82596237 CATTCTTGACATTGATGAAGGGG + Intergenic
1193913370 X:87333333-87333355 GATATTTTACATTGATAAAAAGG - Intergenic
1195588057 X:106588858-106588880 GAAACGTGACATTGGCTAAGTGG - Intergenic
1196812258 X:119638122-119638144 GATAGATGACAGTGACAAGGAGG + Intronic
1198730522 X:139723023-139723045 TATAATTGACATTTATAAAGGGG + Intergenic
1199386574 X:147230055-147230077 GAAACTTTACATATACAAAGGGG - Intergenic
1199408208 X:147487214-147487236 GATACTTGACTTGGACAGTGAGG + Intergenic
1200048750 X:153417182-153417204 GGAACATGAAATTGACAAAGTGG - Intergenic
1201269346 Y:12239348-12239370 GATACTTGGCATTTTCCAAGTGG + Intergenic
1201893698 Y:18971222-18971244 CATGCTTGGCATTGACAATGAGG - Intergenic