ID: 1066182086

View in Genome Browser
Species Human (GRCh38)
Location 10:32972718-32972740
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066182080_1066182086 26 Left 1066182080 10:32972669-32972691 CCACTTTGTCAATGTCAAGTATC 0: 1
1: 0
2: 3
3: 7
4: 173
Right 1066182086 10:32972718-32972740 GTTCTTCCGCTTCACAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr