ID: 1066196229

View in Genome Browser
Species Human (GRCh38)
Location 10:33102836-33102858
Sequence CTGCAGTCCTCAGGCAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066196225_1066196229 5 Left 1066196225 10:33102808-33102830 CCAGATGTGGGGGCCATCTTCAG No data
Right 1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG No data
1066196226_1066196229 -8 Left 1066196226 10:33102821-33102843 CCATCTTCAGAAATCCTGCAGTC No data
Right 1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG No data
1066196220_1066196229 24 Left 1066196220 10:33102789-33102811 CCTTCAGGAAAAAGAGCTTCCAG No data
Right 1066196229 10:33102836-33102858 CTGCAGTCCTCAGGCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066196229 Original CRISPR CTGCAGTCCTCAGGCAAATC TGG Intergenic
No off target data available for this crispr