ID: 1066196860

View in Genome Browser
Species Human (GRCh38)
Location 10:33108713-33108735
Sequence AAAGTTACACAGCTCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066196859_1066196860 9 Left 1066196859 10:33108681-33108703 CCTAACGCTCAGAAAGGGTAAGC No data
Right 1066196860 10:33108713-33108735 AAAGTTACACAGCTCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066196860 Original CRISPR AAAGTTACACAGCTCAGACA TGG Intergenic
No off target data available for this crispr