ID: 1066199371

View in Genome Browser
Species Human (GRCh38)
Location 10:33130341-33130363
Sequence TAGAATTCCTAATATGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066199371_1066199373 -6 Left 1066199371 10:33130341-33130363 CCCAGCTCATATTAGGAATTCTA No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066199371 Original CRISPR TAGAATTCCTAATATGAGCT GGG (reversed) Intergenic
No off target data available for this crispr