ID: 1066199373

View in Genome Browser
Species Human (GRCh38)
Location 10:33130358-33130380
Sequence ATTCTAAATTCAGATAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066199364_1066199373 29 Left 1066199364 10:33130306-33130328 CCACAAGCCAAGCCTCTGCAGGA No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data
1066199366_1066199373 22 Left 1066199366 10:33130313-33130335 CCAAGCCTCTGCAGGAGGTTATA No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data
1066199371_1066199373 -6 Left 1066199371 10:33130341-33130363 CCCAGCTCATATTAGGAATTCTA No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data
1066199368_1066199373 17 Left 1066199368 10:33130318-33130340 CCTCTGCAGGAGGTTATAGGAGC No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data
1066199370_1066199373 -5 Left 1066199370 10:33130340-33130362 CCCCAGCTCATATTAGGAATTCT No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data
1066199372_1066199373 -7 Left 1066199372 10:33130342-33130364 CCAGCTCATATTAGGAATTCTAA No data
Right 1066199373 10:33130358-33130380 ATTCTAAATTCAGATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066199373 Original CRISPR ATTCTAAATTCAGATAAAGC TGG Intergenic
No off target data available for this crispr