ID: 1066202237

View in Genome Browser
Species Human (GRCh38)
Location 10:33152831-33152853
Sequence TTTGTTAACCAGCTACGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066202237_1066202238 -1 Left 1066202237 10:33152831-33152853 CCTTGTCGTAGCTGGTTAACAAA No data
Right 1066202238 10:33152853-33152875 ACCTATTTTTTTTTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066202237 Original CRISPR TTTGTTAACCAGCTACGACA AGG (reversed) Intergenic
No off target data available for this crispr