ID: 1066204509 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:33174707-33174729 |
| Sequence | ATAACGGGGCCTTAAGAAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066204504_1066204509 | 2 | Left | 1066204504 | 10:33174682-33174704 | CCAACATCATCTATCTGAAAAAA | No data | ||
| Right | 1066204509 | 10:33174707-33174729 | ATAACGGGGCCTTAAGAAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066204509 | Original CRISPR | ATAACGGGGCCTTAAGAAAA GGG | Intergenic | ||