ID: 1066204509

View in Genome Browser
Species Human (GRCh38)
Location 10:33174707-33174729
Sequence ATAACGGGGCCTTAAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066204504_1066204509 2 Left 1066204504 10:33174682-33174704 CCAACATCATCTATCTGAAAAAA No data
Right 1066204509 10:33174707-33174729 ATAACGGGGCCTTAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066204509 Original CRISPR ATAACGGGGCCTTAAGAAAA GGG Intergenic