ID: 1066207085

View in Genome Browser
Species Human (GRCh38)
Location 10:33199970-33199992
Sequence AGAACTGAGGTACCATGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066207085_1066207087 -6 Left 1066207085 10:33199970-33199992 CCAAGTCATGGTACCTCAGTTCT 0: 1
1: 0
2: 0
3: 3
4: 134
Right 1066207087 10:33199987-33200009 AGTTCTCCCAGCAAATATGCTGG No data
1066207085_1066207090 2 Left 1066207085 10:33199970-33199992 CCAAGTCATGGTACCTCAGTTCT 0: 1
1: 0
2: 0
3: 3
4: 134
Right 1066207090 10:33199995-33200017 CAGCAAATATGCTGGATGAGTGG No data
1066207085_1066207092 29 Left 1066207085 10:33199970-33199992 CCAAGTCATGGTACCTCAGTTCT 0: 1
1: 0
2: 0
3: 3
4: 134
Right 1066207092 10:33200022-33200044 ATGTGTGCATGGCCTCAATAAGG No data
1066207085_1066207091 18 Left 1066207085 10:33199970-33199992 CCAAGTCATGGTACCTCAGTTCT 0: 1
1: 0
2: 0
3: 3
4: 134
Right 1066207091 10:33200011-33200033 TGAGTGGTCACATGTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066207085 Original CRISPR AGAACTGAGGTACCATGACT TGG (reversed) Intronic
902938086 1:19779212-19779234 AGCACTGAGATACCGTTACTAGG - Intronic
903928837 1:26850639-26850661 GGAACTGAGGTCCCTTCACTGGG + Intronic
904829568 1:33298164-33298186 TGACCTGAGGCACCAGGACTGGG - Intronic
904900633 1:33854529-33854551 AGAGCTGAGGAACTAGGACTGGG - Intronic
907452970 1:54559072-54559094 AGAAGTGAGGTGACATGCCTGGG + Intronic
908930811 1:69314745-69314767 AGTACTGAGGCACCAAGAGTGGG + Intergenic
910287294 1:85569880-85569902 AGAACTGACTTAGCAAGACTAGG - Intronic
912221041 1:107675811-107675833 AACAGTGAGGTACCATGACAGGG + Intronic
916505657 1:165426063-165426085 ACAAATGAAGTACCAAGACTTGG - Intronic
917049407 1:170902355-170902377 AGAAATGAAGAACCCTGACTTGG - Intergenic
917423880 1:174893039-174893061 AGAAATGAGGTAGCCTGGCTGGG - Intronic
917626678 1:176853574-176853596 GGAACTTAGGTAGCAAGACTCGG + Intergenic
917701303 1:177584264-177584286 AAAATTGAGGCACAATGACTTGG + Intergenic
918899338 1:190392433-190392455 AAAAGTGAGGTAACTTGACTTGG + Intronic
919195289 1:194276867-194276889 AGAACAGAGATACCATGAATAGG + Intergenic
920034511 1:203057064-203057086 AGATCTGAGGTAACCTGCCTGGG - Intronic
920210583 1:204325526-204325548 AGAGCTCAGGTCCCAGGACTAGG + Intronic
921070248 1:211652483-211652505 AGAGCTGAGATACCCTGGCTTGG - Intergenic
922876476 1:228943506-228943528 AGAACTCGGGTGCCATGAGTTGG + Intergenic
924286082 1:242488416-242488438 AGACATGAGGTATCATGACATGG + Intronic
1064444103 10:15378527-15378549 AGATGTGAGCTACCATGCCTGGG + Intergenic
1065893213 10:30138590-30138612 AGAACTGAGGAAACTTGGCTGGG - Intergenic
1066207085 10:33199970-33199992 AGAACTGAGGTACCATGACTTGG - Intronic
1067392372 10:45875734-45875756 AGATGTGAGCTACCATGCCTAGG - Intergenic
1067402559 10:45990699-45990721 AGATGTGAGCTACCATGCCTAGG + Intronic
1067870914 10:49960327-49960349 AGATGTGAGCTACCATGCCTAGG + Intronic
1068484505 10:57640263-57640285 AGCACTGGGGTTCCATGATTAGG - Intergenic
1075260677 10:120961541-120961563 ATTACTAAGGTACCATGTCTGGG + Intergenic
1075595128 10:123723819-123723841 AAAACTGGGGTACCATGGGTGGG - Intronic
1086056139 11:82649363-82649385 AGAACTGGGGTTCCATCACTTGG - Intergenic
1087955294 11:104278919-104278941 AGAACTGAGGCAGTATGATTTGG - Intergenic
1088160778 11:106867847-106867869 AGCACTGAGCTACCATGCCATGG - Intronic
1088524183 11:110734883-110734905 AGAACAGAGGTTCCCTGATTTGG - Intergenic
1089517188 11:119040629-119040651 TGACCTGAGGTATCCTGACTGGG + Intergenic
1090083018 11:123626939-123626961 AGAAGTGAGGTAACAAGGCTGGG - Intronic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1108514391 13:51185573-51185595 AGAAATGAGGTAACAGAACTCGG + Intergenic
1109052995 13:57508395-57508417 AGACCTAAGGTTCCAGGACTGGG + Intergenic
1109160772 13:58970928-58970950 AGAAGAGAGGTACCATGCCATGG - Intergenic
1120299597 14:82690035-82690057 AGAATTGATATACCATTACTAGG - Intergenic
1121027330 14:90626238-90626260 AGAACTGGGGGAGCATGTCTTGG + Intronic
1127124286 15:55797128-55797150 AGAAATGAGATAACATGGCTGGG + Intergenic
1127577147 15:60302864-60302886 AGAAATGAGGTATCATTAATTGG - Intergenic
1129828914 15:78654234-78654256 AGAATTGAGGTAACATTGCTGGG + Intronic
1134589261 16:15438736-15438758 AGATGTGAGCTACCATGCCTGGG + Intronic
1135241625 16:20812004-20812026 TGAACTCAGGTAGTATGACTAGG + Intronic
1136988703 16:35138926-35138948 AGAACAGAGATACCAAGAGTTGG + Intergenic
1137871561 16:51954786-51954808 AGAAGTGAAGTAACTTGACTTGG - Intergenic
1139182645 16:64766019-64766041 AAAACAGAGGTACAGTGACTTGG - Intergenic
1151972904 17:77467968-77467990 AGAACTGAGGGACCTAGGCTGGG + Intronic
1153460859 18:5331708-5331730 GGAATGGAGTTACCATGACTGGG + Intergenic
1154402529 18:14054665-14054687 AGCTGTGAGGTACCCTGACTGGG + Intergenic
1161464701 19:4422442-4422464 AGAATTGAGGGACCAAGGCTAGG - Intronic
1165229377 19:34377408-34377430 GGGACTGAGGTACCAGGACACGG + Intronic
927488182 2:23503605-23503627 AGAACAGAGGCACCATGGCCAGG + Intronic
930090866 2:47530364-47530386 AGCCCTGAGGTACCAGGGCTGGG - Intronic
930653194 2:53983104-53983126 AGAACAGGGGTACCTGGACTAGG + Intronic
931188961 2:59981017-59981039 AGAACAGAAGTGCCATGAATGGG - Intergenic
932455871 2:71849734-71849756 AGAGCTGAGCTTCCCTGACTGGG + Intergenic
939373240 2:141329730-141329752 ATAAGTGAGGTATCATGAATCGG + Intronic
943421894 2:187675799-187675821 AGAAATCTGGTGCCATGACTTGG - Intergenic
946941010 2:224770249-224770271 AGAACTGAGGTCCCACTACAAGG - Exonic
947752363 2:232539734-232539756 AGAGCTGAGGCACCATGCATGGG + Exonic
947757166 2:232574908-232574930 GGCACTGAGGTACAAAGACTGGG + Intronic
948347163 2:237308303-237308325 TCAATTGAGGGACCATGACTTGG + Intergenic
1170735845 20:19013551-19013573 AGATCTGAGGTCCCAGGACAAGG + Intergenic
1171006039 20:21466769-21466791 AGAACAGAGGAACCCTGTCTTGG - Intergenic
1172315087 20:33947575-33947597 AGATCTCAGACACCATGACTTGG - Intergenic
1172315482 20:33950855-33950877 AGACATGAGCTACCATGCCTGGG + Intergenic
1173946271 20:46953317-46953339 AGCACTGAGGTTCCATAACCAGG - Intronic
1181590778 22:23883719-23883741 AGACCTCAGGGACCATGGCTGGG + Intronic
1183271370 22:36864603-36864625 AGAAATGAGGAGCCATGCCTTGG - Intronic
950869359 3:16215382-16215404 AAAACTGAGGTCCCATGAGAGGG + Intronic
951744524 3:25962349-25962371 AGAAGGGAGGGATCATGACTTGG + Intergenic
952323166 3:32296746-32296768 AGATCTGAGGTTCCATGGGTGGG + Intronic
953018977 3:39101862-39101884 AGAACTTAGATACCATCAATGGG + Intronic
955974993 3:64471319-64471341 ATAACTGATTTACCATGGCTGGG + Intergenic
956928561 3:74016546-74016568 AGACTTGAGGTAACATGACAAGG - Intergenic
961711937 3:128834494-128834516 TGAAATTTGGTACCATGACTCGG - Intergenic
963444290 3:145383670-145383692 AGAATTGAGGCACCATGGTTAGG - Intergenic
966685606 3:182691421-182691443 AGAAATGAGTGACTATGACTGGG + Intergenic
969146666 4:5130202-5130224 AGCACTGGGGCACCATGACCAGG + Intronic
974478202 4:62410270-62410292 AGAATTGAGGAAACATGACAAGG + Intergenic
975770019 4:77710724-77710746 AGATCTGGGCTAACATGACTAGG + Intergenic
978332686 4:107631730-107631752 AGCACTTTGGCACCATGACTTGG + Exonic
979416844 4:120452057-120452079 AGAAATGAGGAACCATTGCTAGG + Intergenic
980024249 4:127746320-127746342 AAAACAGAGGTATCATTACTGGG - Intronic
981920831 4:150082941-150082963 AGAACTCAGGAATCCTGACTTGG - Intronic
982736491 4:159012141-159012163 AGAACAGTAGTTCCATGACTTGG + Intronic
988194766 5:27990178-27990200 AGATCTGAGTTACCATGAAAAGG - Intergenic
989051808 5:37328345-37328367 AGAAAAGAGGTACCATGAGACGG + Exonic
989399764 5:40996522-40996544 AGAAATGATGGACTATGACTTGG - Intergenic
990914461 5:60889135-60889157 AGAAGTGATGTCCCATAACTGGG + Intronic
991047423 5:62237334-62237356 AACACTGAGGTACCCTGACAAGG + Intergenic
993661092 5:90635926-90635948 ACACCTGTGGTACCATGTCTTGG - Intronic
994397840 5:99240867-99240889 AGAAATGAGGTAGAAGGACTTGG + Intergenic
995850155 5:116536422-116536444 TGGACTGAGTTCCCATGACTCGG - Intronic
996600341 5:125254942-125254964 TGAACTGAAGAACCATGGCTTGG - Intergenic
996966223 5:129309339-129309361 AGAACTGAGAAAACATGCCTGGG - Intergenic
998648779 5:144093756-144093778 TGAACTAAAGTTCCATGACTCGG + Intergenic
999192209 5:149756810-149756832 TGATCTGAGGTTCCTTGACTAGG + Intronic
999845225 5:155471939-155471961 AGAACAGATCTTCCATGACTTGG - Intergenic
1000889663 5:166787560-166787582 AGAGCTGAGGTTCAATGACATGG + Intergenic
1003601342 6:7520274-7520296 AGAAATGAGCCACCATGCCTGGG + Intergenic
1003762749 6:9198839-9198861 TGAACTGAGGCCCCCTGACTAGG - Intergenic
1004105889 6:12667577-12667599 TGAAATTTGGTACCATGACTCGG + Intergenic
1004348220 6:14868022-14868044 TGAACTGAGGTATCATGAGCTGG - Intergenic
1006398280 6:33801231-33801253 AGAACTGAGGGCCCCTGCCTCGG - Intronic
1008752581 6:54754782-54754804 AGAACTGAGGTAAGCTGCCTGGG + Intergenic
1011197046 6:84792351-84792373 AGAACTGGGGTACAAACACTTGG + Intergenic
1014079031 6:117267547-117267569 AAATCTGGGGTAACATGACTGGG - Intronic
1014689546 6:124546260-124546282 GGAACTGAGGGACCATATCTGGG - Intronic
1015599944 6:134902316-134902338 AGAACTGAGGCACCGTGTCAGGG - Intergenic
1015605681 6:134952736-134952758 AGAGCTCAGGTATCAGGACTGGG - Intergenic
1018293367 6:162316286-162316308 TGACATGAGGTATCATGACTGGG - Intronic
1021879260 7:25077834-25077856 AGAACAGAAGCACCATGCCTTGG + Intergenic
1024098884 7:46008543-46008565 AGGAAAGAGGTACCATGAATGGG + Intergenic
1025640224 7:63360174-63360196 AGAACAGAGATACCAAGAATCGG - Intergenic
1025642475 7:63387919-63387941 AGAACAGAGATACCAAGAATCGG + Intergenic
1028611472 7:92717066-92717088 AGACATGAGCTACCATGCCTGGG - Intronic
1029479110 7:100802289-100802311 AGGACTGAGGAACCAGGACAGGG + Intergenic
1031719660 7:125156500-125156522 ATATCTGTGATACCATGACTTGG - Intergenic
1032869775 7:135972319-135972341 AGAACTGAAGTAACTTGACAAGG - Intronic
1033770288 7:144543634-144543656 AAAACTGAGGTTCCATCAGTAGG - Intronic
1040807483 8:51409541-51409563 AGAATTCCGGTACAATGACTTGG - Exonic
1044317371 8:90765444-90765466 GGAAATCAGTTACCATGACTTGG + Intronic
1044909147 8:97038490-97038512 TGAACTGAGGCATCATGCCTTGG + Intronic
1051337074 9:16075623-16075645 AGACCTGAAGCACCATGTCTTGG - Intergenic
1051710419 9:19925685-19925707 AAACCTGAGGTTCCCTGACTAGG + Intergenic
1055840298 9:80495181-80495203 AGAACTGAGGAACCAGGTATTGG - Intergenic
1057502369 9:95605805-95605827 TGAAATGAGGTACCACAACTGGG + Intergenic
1057984992 9:99704063-99704085 GGAACTGAGGGACTAAGACTGGG + Intergenic
1059214678 9:112550009-112550031 AGAGTTGAGTTACCATGATTTGG + Intronic
1061424714 9:130491734-130491756 CAAACTGAGGTACAATGATTAGG + Intronic
1190702612 X:52999749-52999771 ATAACTGAGGCCCCATGACTAGG - Intergenic
1199786503 X:151111284-151111306 AGAAGTGAGGAACCATTTCTGGG + Intergenic
1200082116 X:153582623-153582645 AGAAACGGGGTACCATGACCTGG + Exonic
1200977281 Y:9226804-9226826 AGAACTGTGACACCATCACTGGG - Intergenic