ID: 1066214340

View in Genome Browser
Species Human (GRCh38)
Location 10:33271765-33271787
Sequence CCTAGGGGACACTAGTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066214340_1066214346 22 Left 1066214340 10:33271765-33271787 CCAATACACTAGTGTCCCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1066214346 10:33271810-33271832 TTTGGTGTTATGTATTTCTTAGG No data
1066214340_1066214345 4 Left 1066214340 10:33271765-33271787 CCAATACACTAGTGTCCCCTAGG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1066214345 10:33271792-33271814 TAAGAAAGCTTTTGTCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066214340 Original CRISPR CCTAGGGGACACTAGTGTAT TGG (reversed) Intronic
905007031 1:34718040-34718062 CCTAGGTGATTCTAGTGTGTAGG - Intronic
905849848 1:41265504-41265526 CCTTGGGGTCATTAGTGTAGAGG + Intergenic
916276824 1:163003201-163003223 GAAAGGGAACACTAGTGTATTGG - Intergenic
918987301 1:191649220-191649242 CCTAAGGCACACCAGTTTATGGG - Intergenic
1066214340 10:33271765-33271787 CCTAGGGGACACTAGTGTATTGG - Intronic
1070951996 10:80438645-80438667 CCTAGGGGATTCTAGTATGTAGG + Intergenic
1079170794 11:18093472-18093494 ATAAGGGGAGACTAGTGTATAGG + Intronic
1083900316 11:65640436-65640458 CCCAGGGGCCACTGGTGTCTGGG - Intronic
1090448084 11:126781402-126781424 CCCAGGGGAAACCAGTGTTTTGG + Intronic
1100803922 12:98261486-98261508 TGCAGGTGACACTAGTGTATGGG + Intergenic
1103513984 12:121494816-121494838 CCCAGGGGACCCTAGTGACTTGG - Intronic
1104205097 12:126631465-126631487 CCTAGGGGAAAATGGTGCATGGG + Intergenic
1106383652 13:29264237-29264259 TCCAGGGCACACTAGTGCATGGG + Intronic
1106657492 13:31761719-31761741 CACAGGTGACACTAGTGGATGGG + Exonic
1127344123 15:58077493-58077515 CATAGGCAAGACTAGTGTATTGG + Intronic
1136315709 16:29453797-29453819 CCTTGGGGACACCAGTCTCTTGG - Intronic
1136430286 16:30193139-30193161 CCTTGGGGACACCAGTCTCTTGG - Intronic
1138030071 16:53552890-53552912 CATGGGAGACACTGGTGTATGGG - Intergenic
1138031375 16:53562091-53562113 CCTAGGGGACAGTAATGGAGTGG - Intergenic
1140315206 16:73889676-73889698 CCTACCGGACCCCAGTGTATGGG + Intergenic
1140701129 16:77582497-77582519 CCTAGAGGCCACTAGTGACTTGG + Intergenic
1142616948 17:1142206-1142228 CCCAGGTGACTCTAATGTATAGG + Intronic
1144499121 17:15770035-15770057 CCAAGGGCACACTTGAGTATTGG + Intergenic
1145162503 17:20585070-20585092 CCAAGGGCACACTTGAGTATTGG + Intergenic
1150712421 17:67543317-67543339 CCAATGGGACACTTGTGTTTGGG - Intronic
1151045735 17:70917654-70917676 TCCAGGGCACACTAGTGTAAGGG - Intergenic
1151404431 17:73877579-73877601 CATGGTGGACACTCGTGTATTGG - Intergenic
1152895754 17:82910244-82910266 CCAAGGGGTCACTTGTGGATGGG - Intronic
1156615779 18:38783002-38783024 TCTAGGGCACACTGGTGTAAGGG + Intergenic
927935879 2:27076221-27076243 CCTAGTGGAAACCAGTGTCTAGG - Intergenic
944331846 2:198477840-198477862 TCAAGGAGACATTAGTGTATTGG + Intronic
947454010 2:230236585-230236607 TCTTGGGGACACTAGTCTTTTGG + Intronic
949064002 2:241978599-241978621 CCTGGGGGAGACCATTGTATTGG + Intergenic
1175973590 20:62699279-62699301 CCTTGGGGACTCTTGTGTAAGGG - Intergenic
1182866825 22:33611360-33611382 CCTAGGGCACACTGGTGCAATGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955665777 3:61347959-61347981 GCTAGGGGAAACCAGTCTATGGG - Intergenic
957960075 3:87237583-87237605 TCTAGGGGACACTAGTATCTAGG + Intronic
960146395 3:114208588-114208610 CCTAAGGGAGACTAGAGTATAGG - Intergenic
960400239 3:117188361-117188383 CCTAGGTGACACTAGGTTGTGGG + Intergenic
964388519 3:156174659-156174681 CCTCGGGCACACTGATGTATGGG - Intronic
979312381 4:119218416-119218438 ACTAGTGGAAACTAGTGAATAGG + Intronic
986245692 5:6004684-6004706 CCAAGGGGACCCTAGTGTGACGG + Intergenic
986759628 5:10868323-10868345 CCAAGGGGCCCCTAGAGTATAGG - Intergenic
995117784 5:108500964-108500986 TCTAGGGGACACTGGTGCAAAGG - Intergenic
1001991244 5:176117287-176117309 CCTATGCCACACTAGTTTATTGG + Intronic
1002225631 5:177720849-177720871 CCTATGCCACACTAGTTTATTGG - Intronic
1002268218 5:178050356-178050378 CCTATGCCACACTAGTTTATTGG + Intronic
1011035949 6:82974917-82974939 CCTAGGGTAGCCTAGGGTATAGG + Intronic
1015085816 6:129290389-129290411 CCAAGGGGATACTAGAGTAAGGG - Intronic
1023419239 7:39961497-39961519 TCTAGGGGAGAGGAGTGTATAGG - Intronic
1024816559 7:53277758-53277780 CCTAGGGGAAACCAGAGTAAAGG + Intergenic
1030755288 7:113280377-113280399 TCTCTGGGACACTAGTTTATAGG + Intergenic
1039761343 8:40579854-40579876 TTTAGGGGACACTAGTGCAGAGG - Intronic
1042105332 8:65320222-65320244 CCCAGGAGACACTAATGTCTGGG - Intergenic
1055856287 9:80691891-80691913 CCTAGGGCACACTGGTGTGAGGG - Intergenic