ID: 1066214727

View in Genome Browser
Species Human (GRCh38)
Location 10:33275055-33275077
Sequence AAATATACAATGGTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066214723_1066214727 8 Left 1066214723 10:33275024-33275046 CCAGAGTATTAGAAACAGGATTT No data
Right 1066214727 10:33275055-33275077 AAATATACAATGGTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066214727 Original CRISPR AAATATACAATGGTGGAGCT AGG Intronic
No off target data available for this crispr