ID: 1066215930

View in Genome Browser
Species Human (GRCh38)
Location 10:33287606-33287628
Sequence ACTAGCTATCTCAATAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066215930_1066215932 -3 Left 1066215930 10:33287606-33287628 CCATCACTATTGAGATAGCTAGT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1066215932 10:33287626-33287648 AGTTGACTTGATAAGACCATGGG No data
1066215930_1066215931 -4 Left 1066215930 10:33287606-33287628 CCATCACTATTGAGATAGCTAGT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1066215931 10:33287625-33287647 TAGTTGACTTGATAAGACCATGG No data
1066215930_1066215933 6 Left 1066215930 10:33287606-33287628 CCATCACTATTGAGATAGCTAGT 0: 1
1: 0
2: 0
3: 4
4: 106
Right 1066215933 10:33287635-33287657 GATAAGACCATGGGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066215930 Original CRISPR ACTAGCTATCTCAATAGTGA TGG (reversed) Intronic
902694101 1:18128749-18128771 AGTGGCTAACTCAGTAGTGATGG - Intronic
903313819 1:22484206-22484228 AATAGCTAACTCAATATTGAAGG - Intronic
905216102 1:36408855-36408877 TCTAGCTATTTCAATAGAAAAGG - Intergenic
907170023 1:52454259-52454281 AATAGCTAACACAATATTGAAGG + Intronic
907234494 1:53033133-53033155 ACTACTTATCTGAATAGTCATGG - Intronic
908671090 1:66548383-66548405 CCTACCGACCTCAATAGTGATGG - Intronic
911324679 1:96456249-96456271 ACTAGCCATCACAATATTTAAGG - Intergenic
911403176 1:97402080-97402102 AATAGCTAACACAATATTGAAGG - Intronic
913420380 1:118660693-118660715 GATAGCTATCTGAAGAGTGAAGG - Intergenic
916769512 1:167894475-167894497 ACTATCAATCTTTATAGTGAAGG - Intronic
919347351 1:196401153-196401175 ACTACCAACCTCAATGGTGATGG + Intronic
1063297652 10:4823656-4823678 AATAGATAACTCAATATTGAAGG + Intronic
1065598532 10:27344308-27344330 AATAGCTAACACAATATTGAAGG - Intergenic
1066215930 10:33287606-33287628 ACTAGCTATCTCAATAGTGATGG - Intronic
1067319172 10:45201028-45201050 AATAGCTAACACAATATTGAAGG - Intergenic
1077018736 11:408071-408093 ACCAGCTCTCTGAAGAGTGAAGG + Exonic
1086843969 11:91725159-91725181 ACTAGATATCTCATTTCTGAAGG + Intergenic
1087055359 11:93930482-93930504 AATAGCCAACTCAATACTGAAGG + Intergenic
1087493442 11:98858331-98858353 AATAGCCAACTCAATATTGAAGG + Intergenic
1091126175 11:133100500-133100522 AATAGTTAACTCAATATTGAAGG + Intronic
1091342809 11:134831521-134831543 ACTAGCCAGCACAATATTGAAGG + Intergenic
1091962464 12:4709298-4709320 ACTAGCTAACACAATACTTAAGG + Intronic
1092507874 12:9123424-9123446 AGTAGCTATCTCAATACTGCAGG - Intergenic
1093330546 12:17832498-17832520 AATAGCTAACACAATATTGAAGG + Intergenic
1095885266 12:47182273-47182295 TCTAGCTCTCTCAATACTGTAGG - Intronic
1096564243 12:52463500-52463522 AATAGCTAACACAATATTGAAGG + Intergenic
1099629302 12:85120485-85120507 AATAGCCAACTCAATATTGAAGG - Intronic
1108470082 13:50758747-50758769 ACTGGCTTTCTCCAGAGTGAGGG + Intronic
1109230883 13:59756355-59756377 AAAAGGTATTTCAATAGTGAAGG - Intronic
1110827010 13:79983098-79983120 AATAGCCAACTCAATATTGAAGG - Intergenic
1112625083 13:101094368-101094390 TCTACCTTTCTCTATAGTGAAGG + Intronic
1112673532 13:101670460-101670482 ACTAGGTTTTTCATTAGTGAGGG + Intronic
1114391496 14:22313286-22313308 TCCAGCTATCAAAATAGTGAAGG + Intergenic
1118063359 14:62164673-62164695 ACTAGTTATATGAAGAGTGAAGG + Intergenic
1118258144 14:64223007-64223029 ACTTGCTATCTAAATAGTGCTGG + Intronic
1118840901 14:69510152-69510174 AATAGCCAACTCAATATTGAAGG - Intronic
1120610207 14:86631783-86631805 ACTCCCTTTTTCAATAGTGATGG + Intergenic
1126244182 15:46484662-46484684 TCTAGATGTCTCAATAGTGAAGG - Intergenic
1126296799 15:47148002-47148024 AATAGTTAACTCAATATTGAAGG + Intergenic
1129876052 15:78976502-78976524 ACAAGCTTGCTCTATAGTGAGGG + Intronic
1130295437 15:82644580-82644602 ACTGGCTATCTCTATTTTGATGG - Intronic
1131904078 15:97122159-97122181 ACTAACCAACTCAATACTGAAGG + Intergenic
1144083426 17:11785082-11785104 ACTGCTTATCTGAATAGTGATGG + Intronic
1146960840 17:36976406-36976428 ACTATTAATCTGAATAGTGATGG + Intronic
1159965866 18:74595872-74595894 AATAGCTATTTCAACAGTGTTGG - Intergenic
1162191596 19:8951267-8951289 AGAACCTGTCTCAATAGTGATGG + Exonic
927222678 2:20728575-20728597 ACTAGGAATCACCATAGTGATGG + Intronic
928452734 2:31391459-31391481 AATAGCCAACTCAATATTGAAGG - Intronic
935144561 2:100386699-100386721 ACCAGCCATCTCAACAGAGATGG + Intergenic
939949633 2:148454415-148454437 TCTAGGTACCTCAATAGAGATGG + Intronic
940852047 2:158697244-158697266 AATAGCCAACTCAATATTGAAGG + Intergenic
942432611 2:175929721-175929743 AAAAGCTGTCTCAATAGTGTGGG + Exonic
943336505 2:186621777-186621799 AATAATTTTCTCAATAGTGAGGG + Intronic
943468928 2:188267523-188267545 AATAGCTATTTTATTAGTGAAGG + Intergenic
945688259 2:212998920-212998942 AACAGCTATCTCAAATGTGATGG + Intergenic
945907805 2:215614647-215614669 ACTAGGTATTTCAATAGAGTGGG + Intergenic
946931498 2:224675905-224675927 ACTAGCTACCTGAAAAGTGGAGG + Intergenic
1170722344 20:18894305-18894327 AATAGCCAACACAATAGTGAAGG + Intergenic
1177000937 21:15612177-15612199 AATAGTTAACTCAATATTGAAGG + Intergenic
1177712369 21:24795218-24795240 AATAGCTAACACAATATTGAAGG - Intergenic
1177953462 21:27567947-27567969 ACTAGCTATGTCCACAGTTAGGG - Intergenic
1177998106 21:28128537-28128559 AATAACTATCTCAATCCTGATGG - Intergenic
958581817 3:96035779-96035801 AATAGCTAACACAATATTGAAGG - Intergenic
960492161 3:118330918-118330940 ACCAGCAATTTCAAGAGTGAAGG + Intergenic
962539120 3:136360602-136360624 ACTTGCTATGTCATTACTGAAGG + Intronic
967103037 3:186232119-186232141 AATAGTTATTTCAATTGTGAAGG + Intronic
971716901 4:30189679-30189701 TCTAGCTATCTCATAATTGAAGG - Intergenic
974378787 4:61110913-61110935 ACTAGCAACCTCAAAAGTCATGG - Intergenic
975809431 4:78151088-78151110 ACCAACTATCTCATTAGTGGTGG - Intronic
978135475 4:105253090-105253112 AATAGCCAACTCAATACTGAAGG - Intronic
978399459 4:108315157-108315179 CCTAGGTATCTCAATAATTAGGG + Intergenic
978802562 4:112769601-112769623 ATTAACTATCACAAGAGTGATGG - Intergenic
979176066 4:117665511-117665533 ATTACCCATCTCTATAGTGATGG - Intergenic
979647100 4:123082624-123082646 AATAGCTAATTCAATATTGAAGG - Intronic
979670893 4:123359195-123359217 AATAGCAATGTCAGTAGTGATGG + Intergenic
984259021 4:177422055-177422077 AATAGCTAACACAATATTGAAGG - Intergenic
991928844 5:71731771-71731793 ATTATCTATCTAAATAGTAATGG - Intergenic
992887335 5:81171468-81171490 ACCAACTATCTAAAAAGTGAAGG - Intronic
994961472 5:106609995-106610017 ACAAGTTCTCTCAAAAGTGAAGG - Intergenic
996169078 5:120266342-120266364 ACTAGCTAAAGCAATAGAGAGGG + Intergenic
997184632 5:131869435-131869457 AATAGCCAACTCAATATTGAAGG - Intronic
998178830 5:139921285-139921307 AATAGCCAACTCAATATTGAGGG + Intronic
1000802841 5:165750243-165750265 GCTAACAATCTCAATAGCGAGGG - Intergenic
1000978693 5:167793151-167793173 ACTAACTACCTCAGAAGTGAAGG - Intronic
1001105674 5:168852102-168852124 AATGGCTGTCTCCATAGTGATGG + Intronic
1003287762 6:4749536-4749558 AATAACTATCTGAATAGTGGTGG - Intronic
1006234911 6:32621435-32621457 GCTAGTTATCTCAGTACTGAGGG - Intergenic
1007285112 6:40742016-40742038 AATACCTATCTCATTTGTGATGG - Intergenic
1010472012 6:76239875-76239897 AAGAGCTATCTTAATAGTTATGG + Intergenic
1010540968 6:77091637-77091659 ACCAACTATCTAAAAAGTGAAGG + Intergenic
1011031363 6:82927315-82927337 ACTAGCCAACACAATATTGAAGG - Intronic
1014196105 6:118561035-118561057 TGTTGCTAACTCAATAGTGAAGG + Intronic
1015228778 6:130888998-130889020 AAAAGCTTTCTTAATAGTGAAGG - Intronic
1018863296 6:167728244-167728266 ACTAGCCAACACAATATTGAAGG + Intergenic
1030912522 7:115269547-115269569 ACAAGCTGTCCCAATAGAGATGG + Intergenic
1032949430 7:136890382-136890404 AAAAGCTATCTGAATAGAGAGGG + Intronic
1036580372 8:10068736-10068758 AATAGCTAACTCAATATTAAAGG - Intronic
1043565943 8:81547855-81547877 AATACCTATATCAATAATGATGG - Intergenic
1045811798 8:106230133-106230155 ACTAGCCAACTTAATATTGAAGG - Intergenic
1049053563 8:140217693-140217715 ACTAGCTTGCTCACTAGTGTGGG - Intronic
1057264667 9:93607161-93607183 AATAGCCAACACAATAGTGATGG - Intronic
1059059229 9:111017381-111017403 ATTTGATATCTCATTAGTGATGG - Intronic
1186731797 X:12418226-12418248 ACAAGCTGTCTCTATGGTGATGG - Intronic
1187125883 X:16454042-16454064 TCTTGCTATCTCAATAGAAAGGG + Intergenic
1188754738 X:33948313-33948335 ACTATCTATCTCATTAGGGTTGG - Intergenic
1189720718 X:43913694-43913716 ACAGGCTAGCTCAATAGTGTAGG - Intergenic
1190413058 X:50156146-50156168 ACTAGCTATCCCTATGGTGTCGG + Intergenic
1194717461 X:97303469-97303491 ACTAGCTTTCTCAAGAAAGAAGG + Intronic
1196083738 X:111661357-111661379 ACTGGCTATCACAATAGCAAGGG - Intergenic
1198201538 X:134424312-134424334 ACCAGCTATCTCCATTGTAAAGG - Intronic
1200315475 X:155127988-155128010 GCTAGCTATTTGAAAAGTGAGGG + Intronic