ID: 1066217987

View in Genome Browser
Species Human (GRCh38)
Location 10:33306721-33306743
Sequence AAAAATATTCCCAATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066217983_1066217987 -10 Left 1066217983 10:33306708-33306730 CCTAACATCTGGGAAAAATATTC 0: 1
1: 0
2: 0
3: 22
4: 288
Right 1066217987 10:33306721-33306743 AAAAATATTCCCAATGGGGTAGG No data
1066217980_1066217987 12 Left 1066217980 10:33306686-33306708 CCTAAGGAAAAGCAACTGTATGC 0: 1
1: 0
2: 1
3: 26
4: 230
Right 1066217987 10:33306721-33306743 AAAAATATTCCCAATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066217987 Original CRISPR AAAAATATTCCCAATGGGGT AGG Intronic
No off target data available for this crispr