ID: 1066220748

View in Genome Browser
Species Human (GRCh38)
Location 10:33335085-33335107
Sequence CTCCGCGGGAAGGAAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220737_1066220748 13 Left 1066220737 10:33335049-33335071 CCGTCTGTCTGTCTTTCCCAGAG 0: 1
1: 0
2: 4
3: 60
4: 495
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220735_1066220748 18 Left 1066220735 10:33335044-33335066 CCCGTCCGTCTGTCTGTCTTTCC 0: 1
1: 0
2: 41
3: 188
4: 830
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220740_1066220748 -3 Left 1066220740 10:33335065-33335087 CCCAGAGACCCTGCAGGGATCTC 0: 1
1: 0
2: 2
3: 21
4: 194
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220736_1066220748 17 Left 1066220736 10:33335045-33335067 CCGTCCGTCTGTCTGTCTTTCCC 0: 1
1: 2
2: 33
3: 267
4: 1958
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220741_1066220748 -4 Left 1066220741 10:33335066-33335088 CCAGAGACCCTGCAGGGATCTCC 0: 1
1: 0
2: 2
3: 20
4: 216
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220734_1066220748 19 Left 1066220734 10:33335043-33335065 CCCCGTCCGTCTGTCTGTCTTTC 0: 1
1: 0
2: 10
3: 110
4: 499
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data
1066220733_1066220748 30 Left 1066220733 10:33335032-33335054 CCGAGTGCTCTCCCCGTCCGTCT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1066220748 10:33335085-33335107 CTCCGCGGGAAGGAAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220748 Original CRISPR CTCCGCGGGAAGGAAGGCGC TGG Intronic
No off target data available for this crispr