ID: 1066220834

View in Genome Browser
Species Human (GRCh38)
Location 10:33335420-33335442
Sequence TCGCCCTCCAGCTCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 238}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220834_1066220849 23 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220834_1066220852 29 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220852 10:33335472-33335494 CGCACCGCGAAGCCGGGCGAGGG No data
1066220834_1066220844 -3 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220844 10:33335440-33335462 CGAGGAGGGGAAAGCCGGGCTGG No data
1066220834_1066220845 2 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG No data
1066220834_1066220853 30 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220853 10:33335473-33335495 GCACCGCGAAGCCGGGCGAGGGG No data
1066220834_1066220851 28 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220851 10:33335471-33335493 CCGCACCGCGAAGCCGGGCGAGG No data
1066220834_1066220842 -8 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220842 10:33335435-33335457 GAGGGCGAGGAGGGGAAAGCCGG No data
1066220834_1066220848 22 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220848 10:33335465-33335487 TGGGAGCCGCACCGCGAAGCCGG No data
1066220834_1066220846 3 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220846 10:33335446-33335468 GGGGAAAGCCGGGCTGGAGTGGG No data
1066220834_1066220843 -7 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220843 10:33335436-33335458 AGGGCGAGGAGGGGAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220834 Original CRISPR TCGCCCTCCAGCTCTGGGCA GGG (reversed) Intronic
900004379 1:35099-35121 TAGCCCTCCTGCTCTGTGCCGGG + Intergenic
900024104 1:205615-205637 TAGCCCTCCTGCTCTGTGCCGGG + Intergenic
900204081 1:1424212-1424234 TGTCCCTACAGCGCTGGGCACGG - Intergenic
900476350 1:2878171-2878193 TCACCCACCTTCTCTGGGCAGGG + Intergenic
900585361 1:3430003-3430025 TGGCCCTGGGGCTCTGGGCATGG + Intronic
900609413 1:3538175-3538197 TGGACCTCCTGCTCTGGGCTGGG - Intronic
900797039 1:4714188-4714210 ACAGCCTCCATCTCTGGGCATGG - Intronic
900996558 1:6126294-6126316 CCACCCTCCACCTCTGGGTATGG + Intronic
902817090 1:18922646-18922668 TTGCCCTCCAGGTCCGGGCCCGG - Intronic
902822801 1:18953836-18953858 TCTCCCTCCAAGACTGGGCACGG + Intronic
903779029 1:25810027-25810049 TGGCCCTCCACCTCTGTGCCTGG + Intronic
905282956 1:36860659-36860681 CCGCCCTGCAGCTCTGGGTCTGG + Intronic
906480271 1:46194871-46194893 TGTCCCTCCAGCCCAGGGCAGGG + Exonic
915367466 1:155323978-155324000 TCCCCCTCCAGCACTAGGAACGG - Intronic
916401359 1:164452382-164452404 TAGCCCTCCAACTGTGGGCTGGG - Intergenic
917725140 1:177820962-177820984 TCCCTCTCCACCTCTGGACAGGG + Intergenic
919757372 1:201074434-201074456 TGGCCTTCCAGCTCTGGACAGGG - Intronic
920177134 1:204109011-204109033 TCGCCCCCCTGCTCTCGGCCTGG + Intronic
920309877 1:205042882-205042904 TGCCCCTTCAGCCCTGGGCAGGG + Intergenic
921802968 1:219422449-219422471 TCTCTCTCCTGCTCTGTGCATGG - Intergenic
921836077 1:219780038-219780060 TCTTGCTCCAGCTCTGGCCATGG - Intronic
922458664 1:225797916-225797938 TGGCCATCCAGCCCTTGGCATGG + Intergenic
922801230 1:228365606-228365628 ATGCCCCCCAGCCCTGGGCAGGG - Intronic
922903231 1:229154614-229154636 GGGCGCTCCAGCACTGGGCATGG - Intergenic
924307179 1:242701910-242701932 CTGCCCTCCAGCTTTGGGCACGG - Intergenic
1064393171 10:14959197-14959219 TCGCCCTCCATCTCTGCTCAGGG + Intergenic
1065025378 10:21535097-21535119 GCGCCCTCGAGATCTGGGCCGGG + Intronic
1065727717 10:28682085-28682107 CAGCCCTCCAGCAATGGGCACGG - Exonic
1066220834 10:33335420-33335442 TCGCCCTCCAGCTCTGGGCAGGG - Intronic
1067088347 10:43254372-43254394 TGGCCCTCCTGCTGAGGGCACGG + Intronic
1067415344 10:46098000-46098022 TCTCCCTCCTGCACTGGTCAGGG + Intergenic
1069676312 10:70251236-70251258 TGTCCATCCAGCTCTGGGCTTGG + Exonic
1073293025 10:102422671-102422693 TCTCCCTCCAGCTCGGGGCAGGG - Intronic
1075709565 10:124523342-124523364 TCGTCTTCCAGCTTTGTGCAAGG - Intronic
1075714518 10:124548354-124548376 GCTCCCTGGAGCTCTGGGCAGGG - Intronic
1075951238 10:126479444-126479466 TCGCCCTCCGGATCTGGGATGGG - Intronic
1076347292 10:129788247-129788269 CCTCCAGCCAGCTCTGGGCAAGG + Intergenic
1077299640 11:1841019-1841041 ATGTCCTCCAGCTGTGGGCAGGG - Exonic
1078650945 11:13191583-13191605 CCGCCCTCCAGATCTGAGAATGG - Intergenic
1079386886 11:19988495-19988517 TCGCCCTCCACCTTTGAGCCAGG + Intronic
1079919838 11:26419141-26419163 TCTTCCTCCCGCTCTGGCCATGG - Intronic
1083731288 11:64653926-64653948 CTGCCTTCCAGCTCTGGGGAGGG - Intronic
1083897500 11:65627393-65627415 GCGCCCGGCAGCTGTGGGCAAGG - Exonic
1084632408 11:70362277-70362299 TCCGCCTCCAGCTCTGGGTTGGG + Exonic
1087761991 11:102111239-102111261 GCGGCCGCCAGCTCTGGTCAGGG + Intronic
1089399288 11:118155175-118155197 TCCTCCCCCTGCTCTGGGCAGGG - Intergenic
1089433050 11:118437868-118437890 TTTCCCTCCAGCTCTGGGGAAGG + Intronic
1091299431 11:134498079-134498101 CCTCGCTCCAGCCCTGGGCACGG + Intergenic
1091377800 12:37147-37169 TAGCCCTCCTGCTCTGTGCCGGG + Intergenic
1091493102 12:949735-949757 TCCCCCTCCGGCGCTGGGCGTGG - Intronic
1092289585 12:7151132-7151154 TCCCCCTCCACCTCTGGGAGAGG + Intronic
1094376877 12:29800079-29800101 TGACCCACCAGCTCTGTGCAAGG + Intergenic
1094473236 12:30822653-30822675 TCGCCCTCCCTCTGTGGGCTGGG + Intergenic
1095643925 12:44520180-44520202 TCACACTCCACATCTGGGCAAGG + Exonic
1097167820 12:57094938-57094960 TTGCCCCCTCGCTCTGGGCAGGG - Exonic
1098501930 12:71202903-71202925 TTGCCCTTCAGTTCTGGCCAAGG - Intronic
1099141488 12:78981927-78981949 TAGCCCTCCATCCCTAGGCATGG - Intronic
1099695555 12:86014557-86014579 TCCCCCTCGAGCTCTGAACAGGG - Intronic
1101963904 12:109269031-109269053 TCCCCCTCTATCTCTGGGCTTGG - Intergenic
1102012922 12:109629783-109629805 TCACCCACCAGAGCTGGGCAGGG - Intergenic
1103211809 12:119172755-119172777 TAGCTCTGCTGCTCTGGGCAAGG - Intergenic
1103486135 12:121283963-121283985 ACTCGCTGCAGCTCTGGGCAGGG + Intronic
1103558507 12:121779890-121779912 CCTCTCTCCAGCTCCGGGCAGGG + Exonic
1104387823 12:128366132-128366154 TCGGCCTCCAGCCCAGGGCCGGG + Intronic
1107295880 13:38907135-38907157 TTGACCTCCAGCACTGTGCAGGG - Intergenic
1112173114 13:96994216-96994238 TCTCCCTCCGGGTCAGGGCAGGG + Intronic
1118884355 14:69853958-69853980 TCCCCCTCCAGCCCTAGGCCAGG - Intergenic
1119172425 14:72545272-72545294 TCTCCCTCCAGCTCCAGCCAGGG - Intronic
1122056580 14:99102475-99102497 TCTTCCTCCTGCTCTGGTCATGG + Intergenic
1122420778 14:101575764-101575786 TCTCCCTCCAGACCTGGGGATGG + Intergenic
1122623564 14:103073146-103073168 CCACCCTCCATCTCTGGTCAGGG + Intergenic
1122779679 14:104138443-104138465 GCGCCGCCCAGCACTGGGCAAGG + Intergenic
1202945813 14_KI270726v1_random:25994-26016 TGACCCTGCAGCTCTGGGAAAGG + Intergenic
1126104966 15:45141458-45141480 TCCCTCTTCAGCTCTGGGCTTGG + Intronic
1126478767 15:49094598-49094620 TTGTCCTCCAGCACTGGGAAAGG - Intergenic
1127597181 15:60497348-60497370 TGGCGCTCCAGGTCTGTGCAGGG + Exonic
1128608600 15:69056618-69056640 TGGCTCCCCAGCTCTGGCCAAGG + Exonic
1129525208 15:76209266-76209288 TCTCCAGCCAGCCCTGGGCAAGG + Intronic
1129745964 15:78021404-78021426 TAGCCCTTCAGCTCTAGACAGGG - Intronic
1130411774 15:83654007-83654029 GCGCCCTCCGCCTCTGGGCCGGG + Intergenic
1130658034 15:85806268-85806290 TCCCCCTACAGATCTTGGCAGGG - Intergenic
1131238472 15:90717500-90717522 GCGGCCTCCAGCTCCGGGCCGGG - Intronic
1132449126 15:101955845-101955867 TAGCCCTCCTGCTCTGTGCCGGG - Intergenic
1132943364 16:2519421-2519443 CAGTCCTCCAGCCCTGGGCAGGG - Intronic
1134778895 16:16877573-16877595 TCTCCCTCCAGCTCTAGGGTGGG + Intergenic
1136271507 16:29151581-29151603 TTTACCTCCAGCCCTGGGCAAGG + Intergenic
1136419087 16:30121430-30121452 TCTCCCTTCCGGTCTGGGCAAGG + Intronic
1138024471 16:53511863-53511885 TCGCTCTCCAGCAAAGGGCAAGG + Intergenic
1139377482 16:66509217-66509239 TGGAGCTCCTGCTCTGGGCACGG - Exonic
1139507478 16:67406342-67406364 TGGCCCTGCAGCTCAGGGGAGGG + Exonic
1141137201 16:81474175-81474197 ACGCCCACAAGCTCTGAGCAGGG - Intronic
1141575938 16:84963685-84963707 TCTCCCTCCCGCTCTGCCCAAGG + Intergenic
1141605521 16:85151451-85151473 TCTCCCTCCATCTCTGTGCATGG + Intergenic
1142638199 17:1270639-1270661 TCGCCCCCGGGCTCGGGGCAGGG - Exonic
1142987264 17:3703691-3703713 TTCCCCTCCAGCTCTGGTGAGGG + Intergenic
1143557381 17:7670335-7670357 AGACCCTCCAGCTCTGGGCTGGG + Intronic
1143582395 17:7834772-7834794 TCTCCCTCCAGTTCTCTGCACGG + Intergenic
1143712086 17:8742179-8742201 TCGCCTCCCAGCTCTGGTCCGGG - Intronic
1143750278 17:9022249-9022271 GCGCCCTCCAGCTCTCGGCGGGG - Intronic
1147150785 17:38512456-38512478 TCGCCCTCCTTCCCTGGGCCAGG - Intergenic
1147365288 17:39954951-39954973 TCTCCCTCCTTCTGTGGGCAGGG - Intergenic
1147425586 17:40344550-40344572 TCCCTCTCCAGTTCTGGGCCAGG - Intronic
1147446896 17:40480060-40480082 TGGCCCTCCAGCATGGGGCAGGG + Intronic
1147650549 17:42059347-42059369 TCTCCCTCCAGCCCTGTGCTGGG - Intronic
1148664160 17:49362131-49362153 TCGCCCTCGCGCGCTGGGAAGGG - Intronic
1148852588 17:50562003-50562025 ACGCCCTCCAGATGTGGTCAGGG + Intronic
1148854622 17:50571974-50571996 TCGGCGTCCAGCTGTGGGCAGGG + Exonic
1149100465 17:52900448-52900470 TCTGCCTCCAGCTCTTAGCATGG - Intergenic
1149856753 17:60089242-60089264 TCGTCCTGCAGCTCTGGGGTGGG + Intergenic
1150780581 17:68118172-68118194 TCTGCCTCCAGCTCGAGGCAGGG + Intergenic
1151836438 17:76585651-76585673 GCGCCCTCCCGCTCTGCGCTCGG + Intronic
1152247191 17:79191201-79191223 CCTTCCTCCAGCACTGGGCAAGG + Intronic
1152266042 17:79295488-79295510 GCGCCTTCCAGCTCAGGGAAGGG + Intronic
1152407980 17:80108309-80108331 TCGACCTCCAGCTAAGGGCAGGG - Intergenic
1152477234 17:80526312-80526334 TGGCCCTCCTGCCCTGGGCCCGG + Intergenic
1152518327 17:80839005-80839027 CCACCCTCCAGCCCAGGGCAGGG + Intronic
1152750079 17:82058593-82058615 TTCCCCTCCAGGCCTGGGCAGGG + Intronic
1153617455 18:6947840-6947862 TTTCCCTTCAGCCCTGGGCATGG - Intronic
1155208787 18:23583544-23583566 TTGACCTCCAGCTCTGTGAAGGG - Intronic
1156290704 18:35747089-35747111 TCTCCCTCCAGGGCAGGGCAGGG - Intergenic
1158655453 18:59326906-59326928 TCTCCCTGGAGCTCTGGGTAAGG - Intergenic
1160636131 19:76708-76730 TAGCCCTCCTGCTCTGTGCCGGG + Intergenic
1161039395 19:2101881-2101903 TCGGCCCCCAGCGCGGGGCAGGG + Exonic
1161346142 19:3769728-3769750 TCGCCCAAGAGCTCTGAGCAAGG - Exonic
1162043033 19:7981886-7981908 AGGCCCTCCTGCTCTGGACAAGG - Intronic
1162395812 19:10417650-10417672 TCTCCCTCGACCTCTGGGGAGGG - Intronic
1162600610 19:11665503-11665525 GCTCCCTCCTGCTCTGGGTAGGG - Intergenic
1162693550 19:12453351-12453373 TGGCCATCCAGCCCTTGGCATGG - Intronic
1163020262 19:14477831-14477853 CCTCCCTCCTGCTCTGGGCCAGG + Exonic
1163418656 19:17202089-17202111 TCACCCTGCAGGCCTGGGCAAGG - Intronic
1164539989 19:29115175-29115197 TTGCCCTGAAGCACTGGGCATGG - Intergenic
1164937909 19:32229372-32229394 GCCCCCTCCAGGTTTGGGCAAGG - Intergenic
1165112803 19:33512115-33512137 TCAGGCTCCAGCTCTGGGCATGG + Intronic
1165738631 19:38192976-38192998 CCACCCTCCAGCTCCGGGTAAGG - Intronic
1166213675 19:41322689-41322711 TCCCCATCCAGCTCTGGGCTGGG - Exonic
1166318718 19:42003442-42003464 TCGCCCTCCAGGTTTGGGCATGG - Exonic
1166621430 19:44304854-44304876 CCGCCCTCCAGCGCTGGCCGCGG + Intronic
1167149176 19:47699119-47699141 TCCCTCACCCGCTCTGGGCAAGG + Intronic
1167336290 19:48888086-48888108 TCCTCCTCCAGCCCAGGGCAGGG + Exonic
1168056109 19:53866235-53866257 TCGGCCTCCACCCCTGGGCTTGG + Intronic
1168522201 19:57061284-57061306 TCATCCTCCAGCTCTGTGCAAGG - Intergenic
1168654661 19:58118376-58118398 TCGCCCTCCGACTCTCCGCATGG + Exonic
925551757 2:5084061-5084083 TCTCACACCAGCTCTGGGCAAGG - Intergenic
927154271 2:20212710-20212732 TCTCCCTCCTGCCCTGGGCCGGG - Intronic
927498883 2:23568820-23568842 TCACCCTTCAGTTCTGGCCAAGG + Intronic
927962705 2:27250675-27250697 TAGCCCTGCAGCTCTCAGCAGGG + Intergenic
928244064 2:29612050-29612072 TCGCTCACCAGCTCAGGGCCTGG + Intronic
929580322 2:43078190-43078212 TGGTCCTACAGCTGTGGGCAGGG - Intergenic
931228406 2:60353220-60353242 ACTCCCTCCAGCTCTGGGAAAGG + Intergenic
933766427 2:85712440-85712462 TTCCCCTCCAGCTGTGGGCAAGG + Intergenic
934526155 2:95052975-95052997 GCGCCCTCCAGCTGTGGTCCTGG - Intronic
934945380 2:98537521-98537543 TCCCCCTCACCCTCTGGGCAGGG + Intronic
935267658 2:101408613-101408635 TAGCCATCCAGCTCTGGACATGG + Intronic
935657559 2:105438160-105438182 ACCCCCTGTAGCTCTGGGCAGGG + Intronic
935851882 2:107230642-107230664 TGCCGCTCCAGCTCTGGGTAGGG + Intergenic
935987314 2:108687731-108687753 TTGCACTCCAGCTGAGGGCAGGG - Intergenic
936565350 2:113578342-113578364 TAGCCCTCCTGCTCTGTGCCGGG - Intergenic
938730641 2:134144331-134144353 TCTTCCTCCTGCTCTGGCCATGG - Intronic
940288233 2:152053228-152053250 TCACCCTCAACCTCTGGGAAGGG + Intronic
942840981 2:180360318-180360340 CTGCCCTCCAGCTCTGGCCAAGG + Intergenic
945589778 2:211715688-211715710 TCTTCCTCCTGCTCTGGCCATGG + Intronic
946419080 2:219554771-219554793 GAGGCCTCCAGCTCTGGGCAGGG + Intronic
946571582 2:221029687-221029709 CCACCTTCCATCTCTGGGCAGGG - Intergenic
948638691 2:239359563-239359585 CCACCCCCCAGCTCTGGGAAGGG - Intronic
948866529 2:240777793-240777815 TCGCCTCCCTGCTCTGGGCCTGG + Intronic
1168728867 20:60138-60160 TAGCCCTCCTGCTCTGTGCCAGG + Intergenic
1169473058 20:5904947-5904969 TCTCCCTCCAACTCTGGGGTGGG + Intergenic
1170475254 20:16707918-16707940 TCCCCTTCCACCTCTGTGCAGGG - Intergenic
1172066278 20:32222935-32222957 TTTCCCTCCAGCTCTCTGCATGG - Intronic
1174170645 20:48616181-48616203 TCTCCCTCCAGATCTTGTCATGG - Intergenic
1175741948 20:61425680-61425702 TGGCCATCCTGCCCTGGGCAGGG - Intronic
1175863693 20:62163487-62163509 TCGCACTACAGCTCGGCGCAGGG + Exonic
1176387171 21:6144040-6144062 TCTTCCTCCTGCTCTGGCCATGG + Intergenic
1177294968 21:19162204-19162226 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1179445241 21:41426237-41426259 CCGCACTCCAGCACTGCGCAGGG + Intronic
1179736302 21:43394212-43394234 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1180071388 21:45438400-45438422 TCACACTCCAGGGCTGGGCAGGG + Intronic
1180913514 22:19469760-19469782 TGGCCTTCCAGCTCCTGGCATGG - Intronic
1181869638 22:25887638-25887660 TCGCCTGACAGCTCTGAGCATGG + Intronic
1182183521 22:28376652-28376674 TCAGGCTCCAGCTCTGGGAAGGG + Intronic
1182303775 22:29353905-29353927 GAGCCCTGCAGCTCTGGGGAGGG - Intronic
1182423023 22:30257676-30257698 TCGCCACGCAGCACTGGGCAGGG - Intergenic
1183061080 22:35336748-35336770 CCACCCTCCTGCACTGGGCAGGG + Intronic
1183184106 22:36282096-36282118 TGGGCCTCCACCTCTGTGCAGGG - Exonic
1184168207 22:42743162-42743184 TGGCCCTCGCGCTCTGGGTAGGG + Intergenic
1184453601 22:44597079-44597101 TCCCTCTCCCTCTCTGGGCAGGG - Intergenic
1184475833 22:44720794-44720816 GCGCACTCCTTCTCTGGGCAGGG - Intronic
1185019429 22:48365560-48365582 CCAGCCTCCAGCCCTGGGCAAGG + Intergenic
1185129612 22:49031760-49031782 TCCCCCTCCAGCTGTCAGCATGG + Intergenic
949980662 3:9500210-9500232 TCCCCCTCCAACGCTGGGCTTGG + Exonic
951861127 3:27253919-27253941 TGGCCCTCCAGCTCTCTGCCTGG + Intronic
954415901 3:50393215-50393237 ACTCACTCCAGCTCTGGGCCAGG - Intronic
954417234 3:50399232-50399254 TGGGCCACCAGCACTGGGCAGGG - Intronic
954717437 3:52533634-52533656 TCGCCCTCCTGCCCTGGGTGCGG - Exonic
958531043 3:95330382-95330404 TTGCCCCCCAGTTCTGGCCAAGG + Intergenic
961671771 3:128537437-128537459 TTGCCCTCCAGCCCAGGGGAAGG + Intergenic
962235387 3:133702232-133702254 GGCCCCTCCAGCTCTGGGCAGGG + Intergenic
962821088 3:139047649-139047671 TAGGCCTCCAGCTCTGAGCAGGG + Intronic
962962230 3:140321507-140321529 TCTCTCTCCAGCTTAGGGCAGGG - Intronic
964043962 3:152298843-152298865 TTTCCCTCCGGCTCTGCGCAGGG - Intronic
968077108 3:195822076-195822098 CCGCCCCCCAGATGTGGGCATGG + Intergenic
969421771 4:7101831-7101853 TCCCCCTCCAGCTTGAGGCAGGG + Intergenic
970530193 4:16974020-16974042 TTCCACTCCAGCTCTGTGCATGG - Intergenic
971327172 4:25654225-25654247 TCTGCCTCCAGCCCTGGGCAAGG - Intergenic
973639728 4:52890995-52891017 TCATTCTCCAGCTATGGGCAGGG + Intronic
982136808 4:152280094-152280116 TATCCCACCTGCTCTGGGCATGG - Intergenic
983983090 4:174023477-174023499 TTGCCCTTCAACTCTGGGCTAGG + Intergenic
984697485 4:182793901-182793923 TAGTCCTCCAGCTCTTGGGAAGG - Intronic
985537648 5:473794-473816 TCTGCCTCCAGCTCAGAGCAGGG - Intronic
986856903 5:11879868-11879890 TCTCCCTTCAGAGCTGGGCATGG + Intronic
987313363 5:16701414-16701436 TCGACCTCCTCCTCTGGGTAGGG + Exonic
992173317 5:74125111-74125133 TCATTCTCCAGCACTGGGCAGGG - Intergenic
992962695 5:81971954-81971976 TCGGCCGCGCGCTCTGGGCAGGG - Intergenic
993642428 5:90421449-90421471 TCTCCCTCCAGATCTTTGCAAGG - Intergenic
994840905 5:104923929-104923951 TCCCACTCCAGCTTTAGGCATGG + Intergenic
996202409 5:120692566-120692588 TCTCCTTCCATTTCTGGGCAAGG - Intergenic
998390735 5:141785517-141785539 TAGACCTCCAGAACTGGGCATGG + Intergenic
998508106 5:142688465-142688487 TAGCCCTCCAGCTCTGTGCCTGG + Intronic
1001425859 5:171621968-171621990 TGCCCAGCCAGCTCTGGGCAGGG - Intergenic
1002820048 6:716521-716543 TGGCTCTCCAGTTCTGGCCAGGG + Intergenic
1002852936 6:1012394-1012416 TTGCCCTCCAGCACTGTGCCAGG - Intergenic
1004196085 6:13506633-13506655 TTTCTCTCCAGCACTGGGCACGG - Intergenic
1006606291 6:35259870-35259892 CCGGCCTCCCGCCCTGGGCATGG - Intronic
1007397394 6:41585555-41585577 TGGACACCCAGCTCTGGGCAGGG - Intronic
1010287265 6:74093342-74093364 ACTACCTCCAGCTCTGGGCTGGG + Intergenic
1010344970 6:74800518-74800540 TGTCACTCCAGCTCTGGCCATGG + Intergenic
1012245719 6:96924273-96924295 TTGCCCGCCAGCCCTGGGAAAGG + Intergenic
1012506363 6:99951108-99951130 TTTCCCTCCAGCTTGGGGCAGGG + Intronic
1015005680 6:128278502-128278524 TCACCCTCCACTTATGGGCAAGG + Intronic
1019337394 7:491845-491867 TCAGCCCCCAGCGCTGGGCAGGG + Intergenic
1019417965 7:935807-935829 GTGCCCTCCAGCCCGGGGCATGG - Intronic
1020192569 7:6011316-6011338 ACACCCACCAGCTTTGGGCAGGG - Intronic
1025781289 7:64604102-64604124 TCACTCTCCATCTCTGGTCATGG - Intergenic
1025858411 7:65304514-65304536 TCTCCCTCCTGAACTGGGCAAGG + Intergenic
1026141805 7:67713043-67713065 TCTCCCTCCACCTCCTGGCATGG + Intergenic
1027238144 7:76310275-76310297 TCACCCAGCAGGTCTGGGCAGGG + Intergenic
1029114656 7:98230988-98231010 TGGGCCTCCAGGTCTGGGCTGGG + Exonic
1029373968 7:100166985-100167007 TTGCACTCCAGCTCTTGGGAGGG - Exonic
1033121319 7:138669090-138669112 TCGCCCTCAAGCACAGGGAAGGG + Intronic
1034467807 7:151240082-151240104 TCCCACTCCAGCTCTGGGCTTGG + Intronic
1034528431 7:151680755-151680777 GCGCCCCCCAGCTCTGTGCAGGG + Intronic
1035104615 7:156431823-156431845 TCTTCCTCCTGCTCTGGCCATGG + Intergenic
1035165806 7:156989066-156989088 CCTCCCTCCTGCTCTGGGGAAGG + Intergenic
1035236134 7:157498714-157498736 TCAGCCTCCAGCTCTGGGCCTGG + Intergenic
1035468298 7:159093876-159093898 GCGCCCGTCAGCACTGGGCATGG - Intronic
1036120021 8:6006204-6006226 TCTTCCTCCTGCTCTGGCCATGG - Intergenic
1037967986 8:23148397-23148419 ATGCACTCCACCTCTGGGCAAGG + Intronic
1039597886 8:38807213-38807235 TCCACCTCCATCTCTGGGGAAGG - Intronic
1042562950 8:70087070-70087092 TTGCCCTTCAGCTCTGGCCCTGG - Intergenic
1047384424 8:124396007-124396029 TCGCCCCTCAGTTCTGGCCAAGG + Intergenic
1048977547 8:139681442-139681464 TTCCCCTGGAGCTCTGGGCATGG - Intronic
1049069710 8:140347063-140347085 TGCTCCTCCAGCTCTGGGCCAGG + Intronic
1049633068 8:143669794-143669816 TCCTCCTCCTGCTCTGGCCATGG - Intergenic
1049887074 9:34882-34904 TAGCCCTCCTGCTCTGTGCCGGG + Intergenic
1051437481 9:17048392-17048414 TCTCCCTCCAACTGTCGGCAGGG - Intergenic
1053477809 9:38394654-38394676 TCACCCTCCACCCCTGGGCAGGG - Intronic
1053482147 9:38423868-38423890 GCGCCGTCCACCACTGGGCAGGG + Intronic
1056687605 9:88779293-88779315 GCTCCCTCCAGCCCTGGGCCTGG + Intergenic
1057801499 9:98193827-98193849 AGCCCGTCCAGCTCTGGGCAGGG - Intergenic
1058479244 9:105373964-105373986 ACTACCTCCAGCTCTGGGGATGG - Intronic
1060979514 9:127784597-127784619 TCCCCCTCCAGCTCTGCCCAAGG - Intergenic
1061004748 9:127922103-127922125 TCGGCCCCCAGGTCTGTGCAAGG - Exonic
1061246951 9:129405432-129405454 CCCCCCTCCAGCCCTGGGGAGGG - Intergenic
1061812376 9:133169830-133169852 TCGCCCCCCAGCCTTGAGCAGGG + Intergenic
1061909690 9:133716110-133716132 TCGCCCTCCAGGGCCGGGCTAGG + Intronic
1062308629 9:135923626-135923648 TCTCCCTCCAGTCCTGGGGACGG + Intergenic
1199718764 X:150526862-150526884 TGGTTCCCCAGCTCTGGGCATGG + Intergenic