ID: 1066220835

View in Genome Browser
Species Human (GRCh38)
Location 10:33335421-33335443
Sequence CTCGCCCTCCAGCTCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 10, 3: 30, 4: 313}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220835_1066220853 29 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220853 10:33335473-33335495 GCACCGCGAAGCCGGGCGAGGGG No data
1066220835_1066220842 -9 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220842 10:33335435-33335457 GAGGGCGAGGAGGGGAAAGCCGG No data
1066220835_1066220843 -8 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220843 10:33335436-33335458 AGGGCGAGGAGGGGAAAGCCGGG No data
1066220835_1066220844 -4 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220844 10:33335440-33335462 CGAGGAGGGGAAAGCCGGGCTGG No data
1066220835_1066220851 27 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220851 10:33335471-33335493 CCGCACCGCGAAGCCGGGCGAGG No data
1066220835_1066220849 22 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220835_1066220848 21 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220848 10:33335465-33335487 TGGGAGCCGCACCGCGAAGCCGG No data
1066220835_1066220852 28 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220852 10:33335472-33335494 CGCACCGCGAAGCCGGGCGAGGG No data
1066220835_1066220845 1 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG No data
1066220835_1066220846 2 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220846 10:33335446-33335468 GGGGAAAGCCGGGCTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220835 Original CRISPR CTCGCCCTCCAGCTCTGGGC AGG (reversed) Intronic
900004378 1:35098-35120 TTAGCCCTCCTGCTCTGTGCCGG + Intergenic
900024103 1:205614-205636 TTAGCCCTCCTGCTCTGTGCCGG + Intergenic
900103329 1:971979-972001 CTTGCCCTCCAGAGCTTGGCTGG - Intronic
900418660 1:2546275-2546297 CCCGCCCCCTAGCTCCGGGCCGG - Intergenic
900609414 1:3538176-3538198 ATGGACCTCCTGCTCTGGGCTGG - Intronic
900741644 1:4333823-4333845 CACCCCCTCCAACTCTGGCCTGG - Intergenic
901798193 1:11692323-11692345 CACGCCCGCCAGCTCTGCCCGGG - Intronic
902250742 1:15153182-15153204 CTCCCCCTTCTGCCCTGGGCTGG - Intronic
902467258 1:16625994-16626016 TTCTTCCTCCAGCTGTGGGCCGG + Intergenic
903951662 1:26999172-26999194 CTCTCCCTGTAGATCTGGGCTGG + Intronic
904591994 1:31620106-31620128 CTCTCCCTCCTGCACTGGCCAGG + Intronic
904630526 1:31838527-31838549 CTCACCCTCCAGATCTCAGCTGG - Intergenic
905372057 1:37487594-37487616 CCTGCCCACCAGCTCTGGCCTGG + Intergenic
906561883 1:46764343-46764365 CTCTCCTTCCAGCTCTGCCCAGG + Intronic
906699052 1:47844293-47844315 CTCCCTCCCCAACTCTGGGCAGG - Intronic
907312062 1:53544445-53544467 CTGGCCCCCCACCTCTAGGCTGG + Intronic
910216712 1:84850945-84850967 CTCTCCCACCCGCTGTGGGCTGG + Intronic
912569143 1:110608585-110608607 CACCCCCTGCAGCTCTAGGCAGG - Intronic
912845791 1:113073590-113073612 AGCGCCCTCCAGCTCGGTGCGGG - Exonic
913375179 1:118143786-118143808 CTTCTCCTCCAGGTCTGGGCTGG - Intronic
914342447 1:146771550-146771572 CAAGCCCTGCAGCTCTGCGCAGG - Intergenic
915238476 1:154502491-154502513 CGCCGCCCCCAGCTCTGGGCAGG - Intronic
915286756 1:154858201-154858223 CAGCCCCTCCTGCTCTGGGCTGG - Intronic
916401360 1:164452383-164452405 ATAGCCCTCCAACTGTGGGCTGG - Intergenic
916844774 1:168638493-168638515 CTCAACCTCCATCCCTGGGCTGG - Intergenic
918251718 1:182708893-182708915 CTCCCCAAGCAGCTCTGGGCAGG + Intergenic
919554343 1:199031871-199031893 CTCGGCCTCCAGGTCTGTGATGG + Intergenic
919757373 1:201074435-201074457 ATGGCCTTCCAGCTCTGGACAGG - Intronic
919914465 1:202130920-202130942 CTCCCCCTTCATCTCTGAGCCGG - Exonic
920309876 1:205042881-205042903 CTGCCCCTTCAGCCCTGGGCAGG + Intergenic
922417088 1:225431554-225431576 CTGGCCCACCAGCGCTGTGCTGG + Intergenic
922866117 1:228862911-228862933 CACGCCCTCTAGCGCAGGGCGGG + Intergenic
924408965 1:243783248-243783270 CTCACCCTCAACCTCTGGGAAGG + Intronic
1063498422 10:6531133-6531155 CTCACCCAGCAGCTCTGGGTGGG - Intronic
1064393170 10:14959196-14959218 TTCGCCCTCCATCTCTGCTCAGG + Intergenic
1065025377 10:21535096-21535118 CGCGCCCTCGAGATCTGGGCCGG + Intronic
1066220835 10:33335421-33335443 CTCGCCCTCCAGCTCTGGGCAGG - Intronic
1067160466 10:43821128-43821150 CTCCCCTTCCAGCCCTGGGGTGG + Intergenic
1067656336 10:48194760-48194782 CTCAGCCTACAGCTGTGGGCTGG + Intronic
1070601508 10:77869400-77869422 CGGCCCCTCCTGCTCTGGGCAGG + Intronic
1072804295 10:98414968-98414990 CCCGCCCCTCAGCTCTGGCCCGG + Intronic
1072807215 10:98431187-98431209 CTCGCCTCCCCGCTCGGGGCTGG + Exonic
1073084275 10:100878451-100878473 CTTGACTTCCAGCTCTGGGAAGG - Intergenic
1073293026 10:102422672-102422694 GTCTCCCTCCAGCTCGGGGCAGG - Intronic
1073433017 10:103499141-103499163 GTCCCCCTCCAGCTCTGGCTGGG + Intronic
1074703142 10:116109807-116109829 CATGCCCACCAGCTCTGGGAAGG - Intronic
1074858625 10:117492185-117492207 CACCCCCTCTGGCTCTGGGCTGG - Intergenic
1075951239 10:126479445-126479467 CTCGCCCTCCGGATCTGGGATGG - Intronic
1077299641 11:1841020-1841042 CATGTCCTCCAGCTGTGGGCAGG - Exonic
1077392253 11:2305453-2305475 CTGGGCCTCCAGCTCTGACCTGG - Intronic
1077439939 11:2563390-2563412 CTGGCCCTCCGGCTTCGGGCAGG + Intronic
1079118139 11:17653678-17653700 CAGGCCCCCCAGCACTGGGCTGG - Intergenic
1079273645 11:19013180-19013202 CTAGCCACCCAGCTCTGGGCTGG + Intergenic
1081579624 11:44343374-44343396 CAGGCCCTCCAGGTCTGGGCAGG - Intergenic
1081808959 11:45904753-45904775 CCCGCCCTCCAGCTGTGTCCTGG + Exonic
1083282723 11:61637219-61637241 CTCCCCCTTCTCCTCTGGGCTGG + Intergenic
1083710803 11:64547126-64547148 CTGCCCATCCACCTCTGGGCTGG + Intergenic
1083731289 11:64653927-64653949 CCTGCCTTCCAGCTCTGGGGAGG - Intronic
1083765672 11:64840360-64840382 ATCTCCCAGCAGCTCTGGGCTGG + Intronic
1084004726 11:66316857-66316879 GTCGCCCCCCAGCTCGCGGCAGG + Exonic
1084324275 11:68390590-68390612 CTCGCCCTGCTGCTGTGGTCGGG + Intronic
1084324286 11:68390642-68390664 CTCGCCCTGCCGCTGTGGTCGGG + Intronic
1084324298 11:68390694-68390716 CTCGCCCTGCCGCTGTGGTCGGG + Intronic
1084324309 11:68390746-68390768 CTCGCCCTGCCGCTGTGGTCGGG + Intronic
1084324321 11:68390798-68390820 CTCGCCCTGCCGCTGTGGTCGGG + Intronic
1084324332 11:68390850-68390872 CTCGCCCTGCCGCTGTGGTCGGG + Intronic
1084632407 11:70362276-70362298 TTCCGCCTCCAGCTCTGGGTTGG + Exonic
1084702423 11:70796123-70796145 CTCGCCCACCTGCCCTGGGTGGG + Intronic
1084956945 11:72696641-72696663 CTCGTCCTCAATCTCTGGGTGGG + Exonic
1085047574 11:73362483-73362505 CTCGACGTCCAGCTCCGGCCCGG - Exonic
1087761990 11:102111238-102111260 CGCGGCCGCCAGCTCTGGTCAGG + Intronic
1088172875 11:107017972-107017994 CTCCCCCTCCTCCTCCGGGCTGG + Exonic
1089399289 11:118155176-118155198 CTCCTCCCCCTGCTCTGGGCAGG - Intergenic
1089612737 11:119678488-119678510 CTCATCCTCCAGCTCCAGGCGGG + Exonic
1090401223 11:126449509-126449531 CTCGCTGTCCTGCTCTGAGCTGG + Intronic
1091285474 11:134406177-134406199 CTCGCCCTCCAGACCAGGGAGGG + Intronic
1091377799 12:37146-37168 TTAGCCCTCCTGCTCTGTGCCGG + Intergenic
1091738696 12:2944452-2944474 CTCGGCCTCCAGCTCCTGCCCGG + Intergenic
1094473235 12:30822652-30822674 TTCGCCCTCCCTCTGTGGGCTGG + Intergenic
1095587422 12:43864077-43864099 CTGGCCCACCAGCGCTGCGCTGG + Intronic
1096122017 12:49094436-49094458 CCCGGCCCGCAGCTCTGGGCTGG + Exonic
1097107687 12:56635020-56635042 CTCCTCCCCCAGCCCTGGGCCGG + Intronic
1097167821 12:57094939-57094961 CTTGCCCCCTCGCTCTGGGCAGG - Exonic
1098380925 12:69868604-69868626 CCTCCCCTCCAGCTCTGTGCTGG - Intronic
1099695556 12:86014558-86014580 CTCCCCCTCGAGCTCTGAACAGG - Intronic
1100611190 12:96193561-96193583 CTCGCCCCCCAACTGAGGGCTGG + Intergenic
1100823877 12:98456977-98456999 CTCGGCCTCCTCCTCTGGGGCGG - Intergenic
1101696399 12:107131332-107131354 CTCGCCCACCAGATCCAGGCAGG + Intergenic
1102001963 12:109563063-109563085 CTGCCCATCCAGCACTGGGCTGG + Intronic
1102019843 12:109674688-109674710 TCCCACCTCCAGCTCTGGGCTGG - Intergenic
1103486134 12:121283962-121283984 CACTCGCTGCAGCTCTGGGCAGG + Intronic
1103810735 12:123611443-123611465 CTGGCCCACCAGCCCGGGGCTGG + Intronic
1104387822 12:128366131-128366153 CTCGGCCTCCAGCCCAGGGCCGG + Intronic
1104437002 12:128764618-128764640 CTCGCCCTCCAGGTTAGGGGAGG + Intergenic
1104975399 12:132549843-132549865 CTCGGCCTCCAGCCCAGGCCCGG - Intronic
1105439166 13:20401637-20401659 CTCTCCCTTCAGCTCTGTGTTGG + Intergenic
1105813126 13:24011530-24011552 GATGCCCTCCAGCTGTGGGCTGG + Intronic
1106227191 13:27794276-27794298 CTAGCCCGCCCTCTCTGGGCTGG + Exonic
1108447855 13:50527236-50527258 CCCGCCCTCCTGTTCTGTGCAGG + Intronic
1111268954 13:85854535-85854557 CTCGCCTTACTGCTCTGTGCCGG + Intergenic
1112155202 13:96809649-96809671 CTCGGCCATGAGCTCTGGGCAGG + Intronic
1112506825 13:99980744-99980766 CCCTCCCTCCAGCTCGAGGCCGG - Intergenic
1113025873 13:105940119-105940141 CTCTCTCTCCTGCTCTGGCCTGG + Intergenic
1113747463 13:112754964-112754986 CGCGCCATCCAGCCCTCGGCAGG - Intronic
1115388799 14:32829876-32829898 CTCATCCTCCCGCCCTGGGCTGG + Exonic
1115480659 14:33857998-33858020 CCCTCCCTCCAGATCTTGGCAGG + Intergenic
1117141093 14:52791662-52791684 CTCGCTCTCCGGGCCTGGGCGGG - Intronic
1118137629 14:63046099-63046121 CTCGCGCTCCCGCTCCGGGGTGG - Intronic
1119693607 14:76695529-76695551 CTCGCCGTCCAGCCCAGCGCAGG - Intergenic
1119780240 14:77272269-77272291 CTGGGCCACCAGCACTGGGCTGG - Intergenic
1121035860 14:90703107-90703129 CTTGTCTTCCAGCTCTGGCCAGG - Intronic
1122296344 14:100708477-100708499 CTGGCCCTCCAGGTGAGGGCTGG + Intergenic
1122628692 14:103097632-103097654 GTGGCCCTCCTGCACTGGGCTGG - Intergenic
1123067335 14:105625305-105625327 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123071354 14:105644029-105644051 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123076314 14:105669072-105669094 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123091014 14:105742302-105742324 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123096649 14:105770066-105770088 CTCGCCCTCCAGCTCAAGGCAGG - Intergenic
1123096695 14:105770254-105770276 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123096742 14:105770442-105770464 CTCGCCCTCCAGCTCAAGGCAGG - Intergenic
1123096788 14:105770630-105770652 CTCGCCCTCCAGCTCAAGGCGGG - Intergenic
1123217434 14:106824213-106824235 CTCACCCTACAGTTCTGGGATGG - Intergenic
1123716923 15:23040196-23040218 CTCCCCCACCACCTCTGGCCAGG - Intergenic
1128207562 15:65866779-65866801 CTCACCCTCCACATCTGGGGAGG - Intronic
1128444410 15:67744489-67744511 CTTGCCCTGCAGCTCTTGTCTGG - Intronic
1129562815 15:76589679-76589701 CTCTCCCTCAAGTTCTGGCCAGG + Intronic
1130411773 15:83654006-83654028 CGCGCCCTCCGCCTCTGGGCCGG + Intergenic
1131238473 15:90717501-90717523 AGCGGCCTCCAGCTCCGGGCCGG - Intronic
1132449127 15:101955846-101955868 TTAGCCCTCCTGCTCTGTGCCGG - Intergenic
1132695139 16:1198710-1198732 GTTGGCGTCCAGCTCTGGGCTGG + Exonic
1132850429 16:2022621-2022643 CCCTCCCTCCGGCTCTGTGCTGG + Intergenic
1132852541 16:2031278-2031300 CCCCCCCACCAGCCCTGGGCTGG - Intronic
1133216234 16:4294156-4294178 CTGGCCCTCCAGCCTCGGGCTGG + Intergenic
1134241190 16:12508249-12508271 CTCGCCCTCCGGAGCAGGGCCGG - Intronic
1134321416 16:13167683-13167705 CTCTTCCTCCTGCTCTGGCCAGG + Intronic
1134778894 16:16877572-16877594 CTCTCCCTCCAGCTCTAGGGTGG + Intergenic
1136029799 16:27494710-27494732 ATTGCCCCTCAGCTCTGGGCTGG - Intronic
1138328009 16:56191497-56191519 CTCTCCCTCGAGCTCCCGGCTGG + Intronic
1138965889 16:62083737-62083759 CCCATCCTCCATCTCTGGGCAGG - Intergenic
1139507477 16:67406341-67406363 CTGGCCCTGCAGCTCAGGGGAGG + Exonic
1139991539 16:70943775-70943797 CAAGCCCTGCAGCTCTGTGCAGG + Intronic
1141078965 16:81034385-81034407 CTCCCCCTCAACCTCTGGGGAGG - Intergenic
1141137202 16:81474176-81474198 CACGCCCACAAGCTCTGAGCAGG - Intronic
1141438418 16:84014072-84014094 CTCCTCCCTCAGCTCTGGGCGGG - Intronic
1142479565 17:210553-210575 CTCACTCGCCAGCTCTGGGGCGG - Intergenic
1142558374 17:795035-795057 CCCGCCCTTCAGCACTGGGGTGG - Intergenic
1142987263 17:3703690-3703712 CTTCCCCTCCAGCTCTGGTGAGG + Intergenic
1143030345 17:3964080-3964102 CTCCCCACCCGGCTCTGGGCGGG - Intronic
1143557380 17:7670334-7670356 GAGACCCTCCAGCTCTGGGCTGG + Intronic
1143712087 17:8742180-8742202 CTCGCCTCCCAGCTCTGGTCCGG - Intronic
1143750279 17:9022250-9022272 CGCGCCCTCCAGCTCTCGGCGGG - Intronic
1145214685 17:21042806-21042828 CTCGCCCTCGGGCTCTGGCCGGG + Exonic
1146373900 17:32281557-32281579 CTGGCCCTCCTGTTCTGGGTGGG - Intronic
1146722085 17:35130671-35130693 CTCCTCCTCCAAATCTGGGCTGG + Exonic
1147157755 17:38552771-38552793 CTTCTCCTCCAGCTCAGGGCCGG + Exonic
1147365289 17:39954952-39954974 CTCTCCCTCCTTCTGTGGGCAGG - Intergenic
1147446895 17:40480059-40480081 CTGGCCCTCCAGCATGGGGCAGG + Intronic
1147650550 17:42059348-42059370 CTCTCCCTCCAGCCCTGTGCTGG - Intronic
1148180433 17:45601171-45601193 CCCGCCCTCCAGCTGTGTCCTGG - Intergenic
1148268467 17:46244723-46244745 CCCGCCCTCCAGCTGTGTCCTGG + Intergenic
1148664161 17:49362132-49362154 CTCGCCCTCGCGCGCTGGGAAGG - Intronic
1148846364 17:50532455-50532477 CTCCCCTTCCTCCTCTGGGCCGG - Intergenic
1148854621 17:50571973-50571995 GTCGGCGTCCAGCTGTGGGCAGG + Exonic
1149856752 17:60089241-60089263 CTCGTCCTGCAGCTCTGGGGTGG + Intergenic
1150107298 17:62471797-62471819 CTCCCCCTCCTGCTCTTGACTGG - Intronic
1150780580 17:68118171-68118193 CTCTGCCTCCAGCTCGAGGCAGG + Intergenic
1151882451 17:76903665-76903687 CTCTCCGTCCAGCTGTTGGCTGG - Intronic
1152231461 17:79115901-79115923 CACCCCCTCCTGCTCTGAGCTGG - Intronic
1152407981 17:80108310-80108332 GTCGACCTCCAGCTAAGGGCAGG - Intergenic
1152750078 17:82058592-82058614 CTTCCCCTCCAGGCCTGGGCAGG + Intronic
1153182944 18:2456314-2456336 CTCTTCCTCCAGCTCTGGCCAGG - Intergenic
1154213685 18:12400095-12400117 TTCGTCCTACTGCTCTGGGCAGG + Intergenic
1158718623 18:59902638-59902660 CTCGACTTCCAGCTCTGAGAAGG - Exonic
1159946960 18:74451030-74451052 CTCCCTCTCCAGCCCTGGCCAGG + Intronic
1160636130 19:76707-76729 TTAGCCCTCCTGCTCTGTGCCGG + Intergenic
1160773354 19:843667-843689 CTCTTCCTCCAGCCCTGGCCCGG + Intronic
1160973363 19:1780201-1780223 CTCGGCCTCCCTCCCTGGGCTGG + Exonic
1161039394 19:2101880-2101902 CTCGGCCCCCAGCGCGGGGCAGG + Exonic
1161095578 19:2388539-2388561 CTCACCATCGAGCTGTGGGCAGG - Intergenic
1161358151 19:3831276-3831298 GTCGCCCTCCTGCCATGGGCAGG - Intronic
1161685119 19:5698710-5698732 CCGGCCCTGCAGCTCTGGCCCGG + Intronic
1161715630 19:5874708-5874730 CTCACCCTCCAGCTCCTTGCAGG - Intronic
1162176317 19:8832640-8832662 CTCGCCCTCCAGGCCTGGTACGG - Intronic
1162540825 19:11294937-11294959 CTCTCTGTCCAGCCCTGGGCTGG - Intergenic
1162796888 19:13091730-13091752 CTCCCCTCCCAGCTCTGGGCTGG + Intronic
1162931400 19:13959573-13959595 GTCGTCCTCCAACTCTGGGGAGG - Exonic
1163288497 19:16364086-16364108 CTCGCCCTCCAACCCTGAGGAGG - Intronic
1163452051 19:17384100-17384122 CTGTCCCTCCAGCTATGGGAGGG + Intergenic
1164555738 19:29249444-29249466 CTCTCCCTCCTGCTCTGGCCAGG + Intergenic
1164575912 19:29405150-29405172 CTCTCCCTCGAGCGCTGGGAGGG + Intergenic
1166104405 19:40590285-40590307 CTCGCACTCCAGCACTGTGAAGG - Exonic
1166213676 19:41322690-41322712 GTCCCCATCCAGCTCTGGGCTGG - Exonic
1166930944 19:46301014-46301036 CTCGCCCCCACCCTCTGGGCAGG + Intronic
1167587449 19:50383008-50383030 CTTGCACTCCAGCTCCGGGCTGG - Intergenic
1168095321 19:54111159-54111181 CTCTCCCTCCATGTCTAGGCTGG - Intronic
927154272 2:20212711-20212733 GTCTCCCTCCTGCCCTGGGCCGG - Intronic
927323101 2:21771196-21771218 CACGCCATCCAACTCTGGGAGGG - Intergenic
927717383 2:25361440-25361462 CTTGGCCTCCAACTCTGTGCTGG + Intergenic
928353356 2:30584022-30584044 CTCGCCCCCCACCTCTCAGCAGG + Intronic
931430653 2:62206232-62206254 CCCTCCATGCAGCTCTGGGCTGG + Intronic
935197197 2:100824233-100824255 CCTGCCCTCCAGCCCTGGCCCGG - Intronic
935657558 2:105438159-105438181 CACCCCCTGTAGCTCTGGGCAGG + Intronic
936095487 2:109527926-109527948 CTCGCCCTCCAGCCCTTGCCTGG - Intergenic
936565351 2:113578343-113578365 TTAGCCCTCCTGCTCTGTGCCGG - Intergenic
937286726 2:120758651-120758673 CTCGGCCTGCAGCTTCGGGCGGG + Intronic
938015040 2:127859855-127859877 CCAGCCCTTCAGGTCTGGGCAGG - Intergenic
938382926 2:130846711-130846733 CTGGCTGTCCAGCTCTGGCCTGG - Intronic
940288232 2:152053227-152053249 CTCACCCTCAACCTCTGGGAAGG + Intronic
941973896 2:171382547-171382569 CTTGCCCTCCACCCCTGGACAGG - Intronic
942912764 2:181265473-181265495 CTCGCCCTCCTGCTCTGCCATGG + Intergenic
946305674 2:218855750-218855772 CTCGCCCACCACAACTGGGCTGG - Intergenic
946419079 2:219554770-219554792 TGAGGCCTCCAGCTCTGGGCAGG + Intronic
946571584 2:221029688-221029710 CCCACCTTCCATCTCTGGGCAGG - Intergenic
947621501 2:231593968-231593990 CTCGGCCTTCTCCTCTGGGCTGG + Exonic
947663983 2:231891507-231891529 CTCGGACTTCAGCTATGGGCTGG + Intergenic
947941723 2:234062274-234062296 CCCGCCTTCCAGTTCTTGGCTGG - Intronic
948638693 2:239359564-239359586 CCCACCCCCCAGCTCTGGGAAGG - Intronic
949030480 2:241794556-241794578 CTGGCTTTCCAGCTCTGGGCAGG - Intronic
1169129678 20:3159651-3159673 GATGCGCTCCAGCTCTGGGCCGG + Intronic
1169464734 20:5827338-5827360 CTTGCCCTCCAGCTTCGGGTTGG - Intronic
1169473057 20:5904946-5904968 TTCTCCCTCCAACTCTGGGGTGG + Intergenic
1170394146 20:15907913-15907935 CTCACCCTCAAGCTTTGGGTTGG + Intronic
1170475255 20:16707919-16707941 CTCCCCTTCCACCTCTGTGCAGG - Intergenic
1174224210 20:48983845-48983867 ATCACCCTCCAGCTCAGGCCTGG + Intronic
1174497569 20:50959210-50959232 CTCGCCATGCAGCACTTGGCGGG - Exonic
1175111994 20:56654940-56654962 CTCTTCCTGCAGCTCTGAGCTGG + Intergenic
1176939815 21:14911214-14911236 CCCCTCCTCCAGCTCTAGGCAGG - Intergenic
1178881549 21:36454093-36454115 CAAGGCCTCCAGCTCTGGGGAGG - Intergenic
1178992371 21:37366685-37366707 CCCGCCCGCCGGCTCGGGGCTGG + Intronic
1179524639 21:41967772-41967794 CAGGCCCTCCAGTGCTGGGCTGG + Intergenic
1179637442 21:42722346-42722368 CTCGCCCTGTTGCTCTGGGTTGG + Intronic
1179821972 21:43942341-43942363 CCCGCCTTCCTGCTCTGGGAGGG - Intronic
1179890858 21:44334487-44334509 CCCCCCCTCAACCTCTGGGCGGG + Intronic
1180071387 21:45438399-45438421 CTCACACTCCAGGGCTGGGCAGG + Intronic
1180110198 21:45643847-45643869 CTCGCCGTCCGGCGCAGGGCAGG + Exonic
1181067057 22:20311755-20311777 CTTTCCCTCCATCCCTGGGCTGG - Intergenic
1182423024 22:30257677-30257699 CTCGCCACGCAGCACTGGGCAGG - Intergenic
1182466525 22:30520287-30520309 AACAACCTCCAGCTCTGGGCTGG - Intergenic
1182585107 22:31340477-31340499 CTGGCTCTCTTGCTCTGGGCTGG - Intronic
1183083531 22:35472595-35472617 CTGACCCTGCAGCTCTGAGCTGG - Intergenic
1183184107 22:36282097-36282119 CTGGGCCTCCACCTCTGTGCAGG - Exonic
1183422110 22:37718016-37718038 CCCGCCCACCAGCGCTGCGCTGG - Intronic
1183604916 22:38862715-38862737 CTGACCCTCCAGCCTTGGGCGGG + Exonic
1183663278 22:39233828-39233850 CTCGGCCTCCAGGGCGGGGCCGG + Intronic
1184168206 22:42743161-42743183 CTGGCCCTCGCGCTCTGGGTAGG + Intergenic
1184213881 22:43053504-43053526 CTCTGCCTCCAGCCCTGAGCAGG + Intronic
1185043558 22:48517826-48517848 CTCCCCCGCCCTCTCTGGGCAGG + Intronic
1185269919 22:49924731-49924753 CTCTCCCTCCAGCTCCTGGGTGG + Intronic
949157442 3:846805-846827 CTCTTCCTCCTGCTCTGGCCAGG + Intergenic
952287258 3:31981071-31981093 CTCGCCCTCCTGCTCTCTGGCGG - Exonic
952416337 3:33094215-33094237 CTCCCCCACCAGTTCTGTGCTGG + Exonic
952954475 3:38548719-38548741 CTCACCTGCCGGCTCTGGGCTGG - Exonic
954379523 3:50212293-50212315 CTCGGCCCCCTGCCCTGGGCAGG - Intronic
954417235 3:50399233-50399255 CTGGGCCACCAGCACTGGGCAGG - Intronic
954435490 3:50493752-50493774 CCCCGCCTCCAGCTCTGTGCCGG - Intronic
958432944 3:94063353-94063375 CACTCCCTCCAGCTCTTGGAGGG + Intronic
959592928 3:108099145-108099167 CTCTCGCTCTAGCGCTGGGCTGG - Intergenic
961064141 3:123860222-123860244 CTCCCCCTACACCTCTGGTCTGG - Intronic
961501404 3:127338375-127338397 CCCGCCCTCGACCTCAGGGCGGG - Intergenic
961651705 3:128420163-128420185 CTCCCTCTCCTGCTCTGCGCGGG - Intergenic
961724114 3:128914755-128914777 CTCTGCCCCCAGCTCTTGGCTGG + Intronic
962235386 3:133702231-133702253 AGGCCCCTCCAGCTCTGGGCAGG + Intergenic
962597280 3:136959398-136959420 CTGGCCCTCCAGGTCAGTGCTGG - Intronic
962821087 3:139047648-139047670 CTAGGCCTCCAGCTCTGAGCAGG + Intronic
963335802 3:143972302-143972324 CTCGCCCTCCCGTTGCGGGCGGG + Exonic
963921654 3:150911378-150911400 GTCTCTCTCCACCTCTGGGCTGG + Intronic
964043963 3:152298844-152298866 CTTTCCCTCCGGCTCTGCGCAGG - Intronic
967850880 3:194081946-194081968 CTCTGCCACCAACTCTGGGCAGG - Intergenic
967886011 3:194333887-194333909 CTGGCCCTCCACGTCTGCGCGGG + Intergenic
968008081 3:195256393-195256415 CTCGCCCTCATGCTCCGCGCAGG + Intronic
968500918 4:949703-949725 CTCGCCCTCCAGCCCTGGGAAGG - Intronic
968565320 4:1309560-1309582 CTCCTCCTCCAGCGCTGGCCCGG - Intronic
969253678 4:5988491-5988513 CTCCCCCTCCATCGCTGGTCTGG - Exonic
970457381 4:16238528-16238550 CTTGCTCTCCAGCTGTGAGCTGG + Intergenic
971005668 4:22371757-22371779 CTCTTCCTCCTGCTCTGGCCAGG + Intronic
971197405 4:24482742-24482764 CTCACCCTCCAGATCTCAGCAGG - Intergenic
977950208 4:102962060-102962082 CTCAACCTCCAGGTGTGGGCTGG - Intronic
981655324 4:147106013-147106035 CTCGCCTTACTGCTCTGGCCAGG - Intergenic
985537649 5:473795-473817 CTCTGCCTCCAGCTCAGAGCAGG - Intronic
985549922 5:527982-528004 CAGGCCCTCCAGCTCCAGGCTGG - Intergenic
985684346 5:1273884-1273906 CAATCCCTCCAGCACTGGGCTGG - Intronic
985686065 5:1282313-1282335 CTGGCTGTGCAGCTCTGGGCTGG - Intronic
985780150 5:1866274-1866296 TTCGCCGCCCAGCTGTGGGCAGG + Intergenic
987847488 5:23305149-23305171 CCCGCCCTCCAGCTCTGTGACGG + Intergenic
994478128 5:100297119-100297141 CTCACCCTCCAGCTCTGTTCTGG - Intergenic
997647453 5:135490701-135490723 CTCCACCTCCAGTTCAGGGCCGG + Intergenic
999508087 5:152219077-152219099 CTCCCCTCCCACCTCTGGGCAGG - Intergenic
1002759205 6:188889-188911 CTTTCCCCACAGCTCTGGGCTGG + Intergenic
1004850373 6:19692405-19692427 ATCCCCCTCCAGCTCTGTTCTGG - Intergenic
1005422321 6:25665116-25665138 CTCTCCCTTGAGCACTGGGCAGG - Intronic
1006072259 6:31506483-31506505 CTCGCCTCCCAGCTCTGTCCGGG + Intronic
1006170607 6:32089831-32089853 CTCTCCCTCCAGCTTTGCCCTGG + Intronic
1006651737 6:35557307-35557329 ATCGCCTGCCAGCTCTGGGCAGG + Intergenic
1007397395 6:41585556-41585578 CTGGACACCCAGCTCTGGGCAGG - Intronic
1007727335 6:43924367-43924389 CTCGGCCTCCTGCCCTGGGCTGG + Intergenic
1010287264 6:74093341-74093363 GACTACCTCCAGCTCTGGGCTGG + Intergenic
1010545222 6:77146297-77146319 CTGGCCCTCCAGCTCTCCACTGG + Intergenic
1015920454 6:138261306-138261328 CTGGCTCTTCAGCTCAGGGCTGG - Intronic
1017707874 6:157140659-157140681 CTCGCCATCTGGTTCTGGGCAGG - Intronic
1017888710 6:158621950-158621972 CTCGCCCACCTGCCCTGGGCTGG + Intronic
1018169944 6:161136737-161136759 CCCGCCAGCCAGCTCTGAGCTGG - Intronic
1019170328 6:170130084-170130106 GCCGCCCTACAGCTCTCGGCAGG - Intergenic
1019337393 7:491844-491866 CTCAGCCCCCAGCGCTGGGCAGG + Intergenic
1019625848 7:2015258-2015280 CCCGCTTTTCAGCTCTGGGCTGG + Intronic
1022393950 7:29968959-29968981 CTTGCACTTCATCTCTGGGCCGG + Exonic
1023654378 7:42404973-42404995 CTATCTCTCCAGCTCTTGGCAGG - Intergenic
1023941546 7:44771497-44771519 CTTGCCCTCCCACTCAGGGCAGG - Intergenic
1023987081 7:45103012-45103034 CTCCCCCTCCTGCCCTGAGCTGG + Intronic
1024364014 7:48500768-48500790 CTTGCACTCCAGCCCTGTGCTGG + Intronic
1024919747 7:54544845-54544867 CTCGGCCCCCAGCCCCGGGCCGG - Intronic
1027265110 7:76490478-76490500 CTCCCCGTCCTCCTCTGGGCTGG + Intronic
1027316481 7:76988581-76988603 CTCCCCGTCCTCCTCTGGGCTGG + Intergenic
1028378252 7:90170628-90170650 CTCTCCATCAAGCTCTGGGTCGG - Intronic
1028989510 7:97034524-97034546 CTGGCCCACCAGCACTGCGCTGG + Intergenic
1029114655 7:98230987-98231009 GTGGGCCTCCAGGTCTGGGCTGG + Exonic
1032387444 7:131534355-131534377 CCCTCCCTCCATCTCTGAGCCGG - Intronic
1033431707 7:141295379-141295401 CTGGGTCACCAGCTCTGGGCTGG - Intronic
1033839914 7:145360812-145360834 CTGGCCCACCAGCGCTGCGCTGG - Intergenic
1034443639 7:151100932-151100954 CTCTCCCTGCAGCCCTGGCCTGG + Intronic
1034528430 7:151680754-151680776 CGCGCCCCCCAGCTCTGTGCAGG + Intronic
1034829291 7:154295232-154295254 GTCTCACTCCAGCTTTGGGCTGG - Intronic
1034990997 7:155548235-155548257 CTCACCTTCCACCTCTGGGATGG + Intergenic
1035041211 7:155928875-155928897 CTCTTCCTCCAGCTCTCGCCTGG + Intergenic
1035045294 7:155961758-155961780 CTCCCCTCCCAGCCCTGGGCTGG - Intergenic
1036223030 8:6936841-6936863 GTAGCCCTCCAGGTCCGGGCAGG - Exonic
1037294551 8:17386587-17386609 CTCACCCTCAAACTCTTGGCTGG + Intronic
1038326986 8:26578972-26578994 CTCGCCCTGTAGTTCGGGGCTGG + Intronic
1039476581 8:37842057-37842079 CTCGCCTTCCAGCTGCAGGCCGG - Exonic
1040026556 8:42786943-42786965 CTGGCCCACCAGCGCTGCGCTGG + Intronic
1049042822 8:140125178-140125200 CCCGCCCCCGAGCTCTGGGTGGG - Intronic
1049252518 8:141596857-141596879 CTCTCCCTCCAGCTTGGGGAGGG + Intergenic
1049386907 8:142347435-142347457 CTGTCCCTCCAGCTCCCGGCAGG + Intronic
1049887073 9:34881-34903 TTAGCCCTCCTGCTCTGTGCCGG + Intergenic
1050353683 9:4763405-4763427 CTCAGCCTCCAGCTCTGGCCTGG - Intergenic
1053477810 9:38394655-38394677 CTCACCCTCCACCCCTGGGCAGG - Intronic
1057293924 9:93824578-93824600 GTGGCCCTCCATTTCTGGGCAGG - Intergenic
1060228206 9:121808960-121808982 CTGGCCCTTTGGCTCTGGGCAGG + Intergenic
1061246953 9:129405433-129405455 CCCCCCCTCCAGCCCTGGGGAGG - Intergenic
1061257071 9:129459468-129459490 CTCCGGCTCCAGCTCTTGGCTGG - Intergenic
1061385334 9:130286256-130286278 CGCTGCCACCAGCTCTGGGCAGG + Intronic
1061670256 9:132184525-132184547 CTCTCCCTCCAGCCTTTGGCAGG - Intronic
1061812375 9:133169829-133169851 CTCGCCCCCCAGCCTTGAGCAGG + Intergenic
1061817370 9:133205267-133205289 CTTCTCCCCCAGCTCTGGGCAGG - Exonic
1061939091 9:133874573-133874595 CTTGGCCTCAAGGTCTGGGCGGG - Intronic
1062243033 9:135549959-135549981 CTTCTCCCCCAGCTCTGGGCAGG + Intronic
1062254024 9:135612700-135612722 CACACCCTCCAGCGCTGAGCTGG - Intergenic
1203561145 Un_KI270744v1:59793-59815 CTGGGGCTGCAGCTCTGGGCGGG + Intergenic
1190008043 X:46758891-46758913 CTCGGCCTCCTCCTCTGGGGCGG - Exonic
1192369739 X:70503520-70503542 CTTGCCTTCCAGTTCTGTGCTGG + Exonic
1192561252 X:72129558-72129580 CTTGCTCTCCAGCTCGTGGCCGG + Exonic
1193083703 X:77429505-77429527 CTCCCCTACCACCTCTGGGCTGG - Intergenic
1193965273 X:87976848-87976870 CTCTTTCTCCTGCTCTGGGCAGG + Intergenic
1198154778 X:133948014-133948036 CCCGCACTCCAGCTCTGTGCAGG - Intronic
1200955292 Y:8938363-8938385 CTGGCCCTCGAGCACTGGGCAGG - Intergenic