ID: 1066220837

View in Genome Browser
Species Human (GRCh38)
Location 10:33335425-33335447
Sequence CCTCCTCGCCCTCCAGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 486}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220837_1066220845 -3 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG No data
1066220837_1066220844 -8 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220844 10:33335440-33335462 CGAGGAGGGGAAAGCCGGGCTGG No data
1066220837_1066220853 25 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220853 10:33335473-33335495 GCACCGCGAAGCCGGGCGAGGGG No data
1066220837_1066220849 18 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220837_1066220851 23 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220851 10:33335471-33335493 CCGCACCGCGAAGCCGGGCGAGG No data
1066220837_1066220846 -2 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220846 10:33335446-33335468 GGGGAAAGCCGGGCTGGAGTGGG No data
1066220837_1066220848 17 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220848 10:33335465-33335487 TGGGAGCCGCACCGCGAAGCCGG No data
1066220837_1066220852 24 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220852 10:33335472-33335494 CGCACCGCGAAGCCGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220837 Original CRISPR CCTCCTCGCCCTCCAGCTCT GGG (reversed) Intronic
900087239 1:904442-904464 CCTCCTCCCCCTCCACCGCCAGG + Intergenic
900120657 1:1047349-1047371 CCTCGACGCCCTCCAGCTCCAGG - Exonic
900317863 1:2068383-2068405 CTTCCTGGCCACCCAGCTCTGGG + Intronic
900325001 1:2104391-2104413 CCTTCTTCCCCTGCAGCTCTGGG - Intronic
900401580 1:2474957-2474979 TCTCCTCTCCCTGCAGCTCATGG + Intronic
900641570 1:3690260-3690282 CCTCCTCTCCATGCAGCCCTTGG + Intronic
901049753 1:6420179-6420201 CCACCTGGCCCTCCTGCCCTCGG - Intronic
901234489 1:7660686-7660708 GCTCCTCTCCCACCAGCTCCAGG - Intronic
901537423 1:9891548-9891570 CCTCCTCACCACCCGGCTCTGGG + Intronic
902377233 1:16035503-16035525 GCTCCTCGCCCTCCCTCTCTGGG + Intergenic
902621968 1:17655998-17656020 CCGCCTCCTCCTCCAGCTCCGGG - Exonic
902628608 1:17691295-17691317 CCCCCTCCCCCTCCACCTCAAGG - Intronic
902642432 1:17775352-17775374 CCTCCTCCTCCTCCAGTTCCAGG - Intronic
903136761 1:21314378-21314400 CCTCCTCTCCCTCCAGGGCTTGG + Intronic
903302058 1:22386176-22386198 CCTCCTTGCCCTCATCCTCTGGG + Intergenic
903951660 1:26999168-26999190 CCTCCTCTCCCTGTAGATCTGGG + Intronic
904328235 1:29741311-29741333 CCTCCGCACCCCCCAGCTCGGGG + Intergenic
904470464 1:30732598-30732620 CCTCCGTGGCCTCCACCTCTGGG + Exonic
904746831 1:32716588-32716610 CCTACTCCCCACCCAGCTCTTGG + Intergenic
905332579 1:37216558-37216580 CCTCCTTCCCCTCCAGCCCCTGG - Intergenic
906205376 1:43983806-43983828 CCTCCTCTTCCCCCAGCCCTTGG - Intronic
906263192 1:44408062-44408084 CGACCTCTCCCTCCGGCTCTCGG - Intronic
906609359 1:47191041-47191063 CCACCTGGCCCTCCAGCTCAGGG + Intronic
908326308 1:63027353-63027375 CCTCCTCCTCCGCCAGCTCCTGG - Intergenic
908403791 1:63794454-63794476 CTTCCCCGGCCTCCAGCACTAGG + Intronic
912090169 1:106062727-106062749 CCTCCTTTCTCTTCAGCTCTAGG - Intergenic
912719001 1:112004066-112004088 CCTCCAGGCTCTCCAGCTCCAGG + Intergenic
912902812 1:113671029-113671051 CCTCCTTGCCATCTAGTTCTAGG + Intronic
913239283 1:116815175-116815197 CCCCCTCACCCTCCAGGCCTTGG + Intergenic
914697819 1:150101690-150101712 CATCATTGCACTCCAGCTCTGGG + Intronic
914902070 1:151716321-151716343 CCACCTAACCCTCCAGGTCTTGG - Exonic
915263296 1:154695097-154695119 CCTCCTCACCTCCCACCTCTTGG - Intergenic
916179382 1:162070367-162070389 CGGCCTAGCCCGCCAGCTCTGGG - Intronic
916629230 1:166593779-166593801 CCTCCTCCTCCTCCTTCTCTGGG + Intergenic
917305210 1:173617429-173617451 CCTTCTAGCCTTCCAGCTCTGGG + Intronic
917802996 1:178587239-178587261 CCCCCTCTCTCTGCAGCTCTGGG + Intergenic
917975741 1:180236461-180236483 CCTCCTCTCCTCCCAGCACTGGG - Intronic
920177133 1:204109006-204109028 ACTTCTCGCCCCCCTGCTCTCGG + Intronic
920234683 1:204494807-204494829 CCGCCCCGCCCTCCGGCTCGCGG - Intergenic
920560787 1:206937065-206937087 CCTACTCCCCCTCCCTCTCTAGG + Intronic
921152567 1:212413985-212414007 CCTCCTCCGCCTCCACTTCTCGG - Exonic
921849264 1:219917471-219917493 CCTGCTCTGCCTGCAGCTCTGGG + Intronic
922360397 1:224816224-224816246 CCTCCTCTCCCCACAGCCCTTGG - Intergenic
922424547 1:225480910-225480932 CCTGCTCACCCACCAGCTGTGGG + Intergenic
922712869 1:227846134-227846156 CCTGCTCTCTCTCCAGCTCTGGG + Exonic
922790188 1:228306920-228306942 CCTCCTGGTGCTGCAGCTCTCGG - Exonic
922811163 1:228416443-228416465 CCTCCTCGCCCTCCAACGCCCGG - Intronic
923674013 1:236064929-236064951 CATCCCCGTCCTCCAGCTCCAGG + Exonic
924740823 1:246793481-246793503 ACCCCTCCCCCTCCAGCCCTGGG - Intergenic
924740862 1:246793635-246793657 ACCCCTCCCCCTCCAGCCCTGGG - Intergenic
924740884 1:246793713-246793735 GCCCCTCCCCCTCCAGCCCTGGG - Intergenic
1064564250 10:16624151-16624173 CTTCCCCGCCCTCTAGCTCAGGG + Intronic
1065755236 10:28924832-28924854 CCTCTTCCCCGTCTAGCTCTGGG - Intergenic
1066220837 10:33335425-33335447 CCTCCTCGCCCTCCAGCTCTGGG - Intronic
1067053406 10:43038042-43038064 ACTCCTAGGCCTCCAGCTGTGGG - Intergenic
1067111184 10:43401744-43401766 CCTCCTTTCTCTCCAGCTCCAGG - Intronic
1067853353 10:49769168-49769190 CTTGCTCGCCCTCCAGGCCTTGG - Intergenic
1067972952 10:50992244-50992266 CCTCCTCGCCCCCACGCTCCAGG - Intronic
1069603641 10:69725966-69725988 CCTCCTTCCCCTCCAGCCCCTGG + Intergenic
1069724126 10:70566628-70566650 CCTCCCCGCTCTCCAGCTCGGGG - Exonic
1070290243 10:75109118-75109140 TGTCCTCTCCCCCCAGCTCTGGG + Exonic
1070891140 10:79942852-79942874 CCTGCTTGCCCTGCAGCTCCTGG + Exonic
1072013632 10:91324273-91324295 CCCCCTCCCCCTCCCCCTCTCGG - Intergenic
1072807213 10:98431183-98431205 CCTCCTCGCCTCCCCGCTCGGGG + Exonic
1073084277 10:100878455-100878477 GCTCCTTGACTTCCAGCTCTGGG - Intergenic
1073251096 10:102120696-102120718 CCCCTTCGCCCTCCCTCTCTGGG - Intergenic
1073580675 10:104663051-104663073 CCGTCTCTCCTTCCAGCTCTGGG + Intronic
1073878332 10:107950809-107950831 CCTCCTCCCTCCCCAGCTGTGGG + Intergenic
1074682483 10:115922052-115922074 CCTCCTTGACCTACAGCCCTGGG - Intronic
1074719134 10:116249403-116249425 CCTCCTGGACCTCCAGTTCTTGG - Intronic
1074765765 10:116698977-116698999 CCTTCTCTCCCTCTAGCTCCTGG + Intronic
1075822740 10:125328715-125328737 CACCCTCACCCTCCAGCACTTGG - Intergenic
1075913640 10:126147627-126147649 CCTCCTCAGCCTCCAGCTGTTGG + Intronic
1075951241 10:126479449-126479471 GCTCCTCGCCCTCCGGATCTGGG - Intronic
1076138339 10:128060379-128060401 TGTGCTCGCCTTCCAGCTCTGGG + Intronic
1076491140 10:130862350-130862372 GCTCCCCTCCCTCCAGCCCTGGG + Intergenic
1076713782 10:132353153-132353175 CCTCCTCGACCTCCTGCTGGGGG - Intronic
1077093581 11:790127-790149 CCTCCCCGCCCTCCTGCGCCGGG - Intergenic
1077241433 11:1512721-1512743 CCTCCTAGCGCTGCAGCACTGGG - Intergenic
1077333602 11:1993963-1993985 CCCCCTCCCCATCCAGCTGTGGG - Intergenic
1077442215 11:2574161-2574183 CCACCTGGCCCTGCAGCTGTGGG - Intronic
1077479587 11:2807440-2807462 CCTCCTCGCCCCCCCACTCCGGG + Intronic
1077549213 11:3192615-3192637 CCTACTCCTCCTTCAGCTCTGGG + Intergenic
1078362676 11:10681204-10681226 TCTCCCAGCACTCCAGCTCTGGG - Intronic
1080185062 11:29472853-29472875 CCCCCCCGCCCTCCAGCTACTGG - Intergenic
1080387051 11:31816582-31816604 CCTGCTCGCCGCCCAGCTCCAGG + Intronic
1080897258 11:36456978-36457000 CCCCCTCTGGCTCCAGCTCTTGG + Intronic
1083198168 11:61103221-61103243 CCTGCTCTCACTCCAGCCCTGGG + Intronic
1083629974 11:64090465-64090487 CCTCCTCCTCCTCCACCTCAGGG - Intronic
1083755725 11:64790600-64790622 CCTCATCTCCCTCCAGGGCTGGG + Intronic
1084566522 11:69931779-69931801 CCCCCTCCCCATCCACCTCTTGG + Intergenic
1084590638 11:70088060-70088082 CCTCGTCCCGCTCCAGCTCCAGG - Exonic
1084593186 11:70102355-70102377 CATCCTCGCCAGCCAGCGCTCGG + Intronic
1084702420 11:70796119-70796141 CCACCTCGCCCACCTGCCCTGGG + Intronic
1084742106 11:71146587-71146609 CCTCCTGTCCCTCCAGCCCTGGG - Intronic
1084863781 11:72039851-72039873 GCTCCTCCTCCTCCAACTCTAGG + Intronic
1084942803 11:72622680-72622702 CCTCCTCTGTCTCCAGCTCCTGG - Intronic
1084956942 11:72696637-72696659 CCTCCTCGTCCTCAATCTCTGGG + Exonic
1084973411 11:72783477-72783499 CCTCCTCTGCCTCTAACTCTAGG + Intronic
1087556331 11:99726112-99726134 TCTCCTCTCCCTCTATCTCTGGG + Intronic
1088686473 11:112288450-112288472 CCTTCTTGGCCTCCAGGTCTTGG - Intergenic
1089297800 11:117480536-117480558 CCTCCCGGATCTCCAGCTCTGGG + Exonic
1089341276 11:117759463-117759485 CCTGCTTGCCTTCCAGCCCTGGG - Intronic
1089441563 11:118522187-118522209 CCTCCTTGCACTCCAACACTGGG - Exonic
1090000460 11:122952131-122952153 CCCCCTCCGCCTCCAGCCCTAGG - Intronic
1090817834 11:130314598-130314620 CCTCCTCGCACTCCCACTCGCGG - Exonic
1091224789 11:133950876-133950898 CCTCCTCCTCCTCCTCCTCTGGG + Intronic
1091339673 11:134800627-134800649 CCGCCTCTCCTTCCACCTCTGGG + Intergenic
1202816582 11_KI270721v1_random:49145-49167 CCCCCTCCCCATCCAGCTGTGGG - Intergenic
1091390935 12:125738-125760 CCTCCTCCTCCTGCAGCTCCTGG - Exonic
1091449591 12:564182-564204 CCTTCCCACCCTCCAGGTCTGGG + Intergenic
1091701536 12:2666664-2666686 CCTCCTCTCCCTCCTCTTCTAGG + Exonic
1091805310 12:3351809-3351831 CCTACTCTAGCTCCAGCTCTAGG + Intergenic
1091889881 12:4045034-4045056 CCTCCTGGTCTTCCAGCCCTTGG - Intergenic
1092136046 12:6147985-6148007 ACTCCTTGCCCTCCAACTCCTGG + Intergenic
1092289583 12:7151127-7151149 TATCCTCCCCCTCCACCTCTGGG + Intronic
1093090022 12:14910685-14910707 GCTCCTCCTCCCCCAGCTCTGGG + Intergenic
1093935257 12:24993945-24993967 CCTCCTGGCCCTCCATCTGCTGG + Exonic
1094101210 12:26765799-26765821 CCTCCTCTTCCACCAGCCCTCGG + Intronic
1094462785 12:30715497-30715519 CCTCCTCTCCCCCCAGCCCCTGG - Intronic
1095956915 12:47812172-47812194 CCTCCTCGCCCTGCCTCACTGGG + Intronic
1096123875 12:49105840-49105862 CCCCTTCTCCCTCCAGCTCCAGG + Intronic
1096372893 12:51083466-51083488 CCTCCCCGCCCTGCCGCCCTGGG - Exonic
1096595482 12:52692425-52692447 TCTCCTCGCCCTCCAGCAGCTGG + Exonic
1097777752 12:63668288-63668310 CCTCCTCTACCTCCGGCTCCCGG + Exonic
1097829814 12:64212308-64212330 CCTCCTTCCCCTCCAACTCCTGG + Intronic
1099141490 12:78981932-78981954 ACTCCTAGCCCTCCATCCCTAGG - Intronic
1099969673 12:89487797-89487819 CCTTCTCTCCCCTCAGCTCTGGG + Intronic
1101535678 12:105614148-105614170 CTTGCTCGCTCTCCAGCTCCAGG + Intergenic
1101700449 12:107168958-107168980 GCTCCTCTCCCACCACCTCTGGG - Intergenic
1101843384 12:108343127-108343149 CCTCCTCCCACTCCAGGTCCAGG - Intergenic
1103136175 12:118509812-118509834 CTTCCTCCCCCACCAGCTCTTGG + Intergenic
1103701785 12:122851855-122851877 CCTCCTCACCCTCCCTGTCTTGG - Intronic
1104248115 12:127062251-127062273 CTGCCTCTCCCTCCATCTCTGGG + Intergenic
1104387821 12:128366127-128366149 CCTGCTCGGCCTCCAGCCCAGGG + Intronic
1104811504 12:131622627-131622649 CCACCTTGCCCTCCCTCTCTGGG + Intergenic
1105805645 13:23950403-23950425 CCTCCTCCCCCTCCTCATCTAGG + Intergenic
1106227189 13:27794272-27794294 CCTCCTAGCCCGCCCTCTCTGGG + Exonic
1108358957 13:49652316-49652338 CCTTCATGCCTTCCAGCTCTGGG - Intergenic
1108696212 13:52904655-52904677 CCTCCCTGCTCTCCGGCTCTGGG - Intergenic
1108937606 13:55903091-55903113 CCTCCTTACCCTTCAGCTGTCGG - Intergenic
1109966220 13:69699910-69699932 CTTCCTCTCCCTCCAGCCCCTGG - Intergenic
1112403835 13:99100323-99100345 TCTCCTCTCCCTCCAGCCCCTGG - Intergenic
1112508860 13:99991245-99991267 CCCGCGCGCCCTCCAGCCCTCGG + Intergenic
1112569258 13:100579304-100579326 CCTCCTCTCCCCACAGCTGTGGG - Intronic
1112741179 13:102473993-102474015 CCTCCTCAACCTCCACCTCCCGG - Intergenic
1113308746 13:109108776-109108798 CCTTCTCACCCTTCAGATCTGGG - Intronic
1113318912 13:109213325-109213347 CCTCGTTACCCTCCAGCACTGGG - Intergenic
1113799089 13:113077322-113077344 CCTCCTCCCCTTCCACCTCCGGG + Intronic
1114265035 14:21069012-21069034 CATCATCGCCCTCCAGCTGCAGG + Intronic
1116797936 14:49411802-49411824 ACTCCTCTCTCTCCAACTCTCGG - Intergenic
1116831248 14:49722022-49722044 TCTCCTCTGCCTCCAGCTGTTGG + Intronic
1118734061 14:68689784-68689806 CCTCCTTGCTCTCCTGCCCTTGG - Intronic
1119741173 14:77014532-77014554 CCTCCTGGAACTGCAGCTCTGGG + Intergenic
1120544971 14:85799912-85799934 CCTCCTCGCACTCCATATCCAGG - Intergenic
1121316403 14:92963593-92963615 CCTCCTCGCCCTTCACAGCTTGG + Intronic
1121781764 14:96626579-96626601 CCACGTCACCCTCCAGGTCTCGG - Intergenic
1122062821 14:99148186-99148208 CCTCCACTCCCACCTGCTCTGGG - Intergenic
1122690917 14:103531847-103531869 CCTCCTCCCACTCCAGCTTCAGG - Intronic
1122691389 14:103533549-103533571 CCTCCTAGGCTTCCTGCTCTGGG + Intronic
1122916937 14:104863807-104863829 CCCCCCCGCCCTCCAGCCCAGGG + Intergenic
1123067338 14:105625309-105625331 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123071357 14:105644033-105644055 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123076317 14:105669076-105669098 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123091017 14:105742306-105742328 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123096651 14:105770070-105770092 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123096698 14:105770258-105770280 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123096744 14:105770446-105770468 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1123096791 14:105770634-105770656 AGGCCTCGCCCTCCAGCTCAAGG - Intergenic
1124848059 15:33310906-33310928 CCACCTCCTCCTCCAGCTCCTGG - Intergenic
1126104965 15:45141453-45141475 CCTCGTCCCTCTTCAGCTCTGGG + Intronic
1128526325 15:68414764-68414786 CCTCCTTCCCCTCTAGCACTTGG + Intronic
1129493257 15:75950513-75950535 CCTCCTCATCCCCCAGCTCCAGG + Intronic
1129515112 15:76152531-76152553 CCTCCTCCCGGTCCAGCTCCTGG + Intronic
1129753709 15:78083352-78083374 GCCCCTAGCCCTCCAGCGCTCGG - Intronic
1130040820 15:80404294-80404316 CCTCCTCGGCCTCCTCCTCCCGG - Intergenic
1131166510 15:90145646-90145668 TCCCCTCTCCCACCAGCTCTGGG - Intergenic
1131232687 15:90671094-90671116 CCCCATTGCACTCCAGCTCTGGG + Intergenic
1132380867 15:101365891-101365913 CCTCCTCCCCTCCCAGCTCCTGG - Intronic
1132502902 16:292519-292541 CCTCCCGGGCCTCCAGCTTTGGG - Intronic
1132543125 16:520710-520732 CCTGCTTGCCCTACAGCTCATGG + Exonic
1132641615 16:980895-980917 CCTCCCCGCCCCCGAGCCCTAGG + Intronic
1132670582 16:1100769-1100791 CCTCCTCCCCCTGCACCTCTAGG - Intergenic
1132936447 16:2483695-2483717 CCTCCTCTCTCTCCAGCTCAGGG - Intronic
1132994346 16:2815252-2815274 CCTCCCTGCCCTCCAGGTGTGGG + Intergenic
1132996681 16:2827175-2827197 CCTCCCTGCCCTCCAGGTGTGGG - Intergenic
1133222394 16:4324310-4324332 GCTCCTCCCCCTCCAGTCCTGGG + Intronic
1133230187 16:4362679-4362701 CCTCCACGCCCTCCAGCCTGGGG - Exonic
1133538106 16:6721592-6721614 TCTCCTTACCCTCCAGCTCCTGG + Intronic
1133727455 16:8550737-8550759 CCTCCTAACACTCCAGCTCTTGG + Intergenic
1134778891 16:16877568-16877590 TTGCCTCTCCCTCCAGCTCTAGG + Intergenic
1136172260 16:28496265-28496287 CCTCATCCCCCTCCTCCTCTAGG - Exonic
1136235414 16:28910849-28910871 ACTCCTCGCCCTCCTGCCCTAGG + Intronic
1136428327 16:30183676-30183698 CCTCCTCCACCTCCGGCTTTTGG + Exonic
1136922801 16:34345889-34345911 CATCCTCCCTCCCCAGCTCTGGG + Intergenic
1136981772 16:35065917-35065939 CATCCTCCCTCCCCAGCTCTGGG - Intergenic
1137397898 16:48129564-48129586 CCTCCAGGCTCTCCAGCTGTGGG - Intronic
1137840574 16:51637064-51637086 GCTCCATGCCCTCCAGCACTGGG + Intergenic
1138496995 16:57415065-57415087 GCTCCTCTCCCTGCAGCTCGAGG + Exonic
1138551642 16:57751924-57751946 CCTGCCCTGCCTCCAGCTCTGGG + Exonic
1138576823 16:57912988-57913010 CCTCCTCTCCCTCCAGTACATGG - Exonic
1138619121 16:58197832-58197854 CCTCCTCCTCCTCCAGCGCCCGG - Exonic
1138714494 16:59005511-59005533 CGTCATGGCACTCCAGCTCTGGG + Intergenic
1139894142 16:70274680-70274702 CGTCATTGCACTCCAGCTCTGGG + Intronic
1140177658 16:72679950-72679972 CCTCCTCACCCTGCAGCCCCTGG - Intergenic
1141699983 16:85637947-85637969 CCACCTCCCCCTGCAGCTCTGGG - Intronic
1142125970 16:88410903-88410925 CCTCCTCCTCCTCCAGCCCCTGG + Intergenic
1142153267 16:88521919-88521941 CCTCCTCACCCTCCAGGTCTCGG + Intronic
1142244456 16:88963153-88963175 CCTTCTCTCCCTCCGGCCCTGGG - Intronic
1142286014 16:89171846-89171868 CCTCCTCGTCCTCGGGCTGTTGG + Exonic
1142479989 17:213351-213373 CTCCCTCTCCCTTCAGCTCTGGG - Exonic
1142852158 17:2709514-2709536 CCTCCTCCTCCTCCCCCTCTGGG + Intronic
1143475782 17:7203323-7203345 CCTCCCCTCCATCCAGGTCTTGG - Exonic
1143750284 17:9022254-9022276 GCCCCGCGCCCTCCAGCTCTCGG - Intronic
1143917543 17:10305050-10305072 CCTCCCCACCCTCCACCTCCTGG + Intronic
1144621094 17:16818946-16818968 CATCCTCGCCCTCCAGCAGGCGG + Intergenic
1144623017 17:16830399-16830421 CGTCCTCGCCCTCCAGCAGGCGG + Intergenic
1144625421 17:16841967-16841989 CATCCTCGCCCTCCAGCAGGCGG + Intergenic
1144881008 17:18430754-18430776 CATCCTCGCCCTCCAGCAGGCGG - Intergenic
1144883413 17:18442317-18442339 CGTCCTCGCCCTCCAGCAGGTGG - Intergenic
1145005410 17:19334615-19334637 CCTCCCCACCCCCCAGCCCTAGG + Exonic
1145151223 17:20513633-20513655 CATCCTCGCCCTCCAGCAGGCGG + Intergenic
1146262709 17:31432181-31432203 CTTCCTCTCTCTCCCGCTCTGGG + Intronic
1147186423 17:38715787-38715809 CCTCCTCTTCCTCCTCCTCTGGG + Exonic
1147425588 17:40344555-40344577 CCTCCTCCCTCTCCAGTTCTGGG - Intronic
1147430322 17:40366866-40366888 CCACCACTCCCTCCAGCTCAGGG + Intergenic
1147573072 17:41583239-41583261 CGTCCTCGCCCTCCAGCAGGCGG + Exonic
1147577341 17:41610335-41610357 CATCCTCGCCCTCCAGCAGGCGG + Exonic
1147864887 17:43545662-43545684 CCCCCTCCCCCACCAGGTCTCGG - Exonic
1148430539 17:47639603-47639625 CCTCCTCCACCTCCATCTCCAGG - Intergenic
1148619337 17:49022602-49022624 CCTCCTCCCCCTCCCTCTCCTGG + Intronic
1151225459 17:72644718-72644740 CCTCCTCCTCCTCCAGCGGTGGG + Intergenic
1151542333 17:74770927-74770949 GTTCCTCACCCTCCATCTCTGGG - Exonic
1151560255 17:74866077-74866099 CCTCCCCGCCCCTCAGCCCTTGG - Intronic
1151585967 17:75008698-75008720 CTTACTCGGCCTCCAGCTCCTGG + Intergenic
1152190276 17:78883836-78883858 CCCCCTCCCTCTGCAGCTCTGGG + Intronic
1152241478 17:79163555-79163577 CCATCCTGCCCTCCAGCTCTGGG - Intronic
1152623831 17:81379431-81379453 CCTGCTTCCCCTCCAGCTCCTGG - Intergenic
1152659853 17:81537165-81537187 CCTCCTCCACCTCCAGCTGCAGG - Intergenic
1155168853 18:23252201-23252223 CATCCACTCCCTCCAGCTCCTGG - Intronic
1155546192 18:26918418-26918440 CCACCACTCCCTCCACCTCTAGG - Intronic
1156340271 18:36204237-36204259 CCTCCTCCCCTTCCAACCCTTGG + Intronic
1157289586 18:46400128-46400150 GCTCCTCCAGCTCCAGCTCTAGG + Intronic
1158119299 18:54030571-54030593 CCTCCTTCCCCTCTAACTCTGGG - Intergenic
1158192045 18:54841102-54841124 CATCATTGCACTCCAGCTCTGGG + Intronic
1159405510 18:67997585-67997607 CATGCTCGCACTCCTGCTCTTGG + Intergenic
1159516543 18:69466170-69466192 CCGCCCCTCCCTCCAGCCCTTGG + Intronic
1160419601 18:78735089-78735111 CCTCCAAGCCCTCCTGCTCTGGG + Intergenic
1160662872 19:309156-309178 CCTCAGAGCCCTCCAGCTCCTGG + Intronic
1160808265 19:1001787-1001809 CCGCCTCTCCCACCAGCCCTAGG - Intronic
1160913172 19:1484022-1484044 CCTACTTGGCCTCCAGCGCTAGG + Exonic
1160975794 19:1791855-1791877 CCTCCTCCCCCACCAGCTGCTGG - Exonic
1160983417 19:1827007-1827029 CCTCCTCCACCTCCAGCGCGGGG - Exonic
1161337344 19:3721705-3721727 CCTCTTCCTCCTCCAGGTCTCGG - Intronic
1161849459 19:6731105-6731127 CCGCCCCGTCCCCCAGCTCTTGG - Exonic
1161881134 19:6953742-6953764 CTTCCTAGCCCTCCAAATCTAGG + Intergenic
1162895579 19:13763146-13763168 CCGGCTCGCCCACCAGCCCTGGG + Exonic
1162911675 19:13851146-13851168 CCTCCTTGCCCTCCTGAGCTCGG - Intergenic
1163197103 19:15729899-15729921 TCTCCATGCCCTCCAGCCCTAGG + Intergenic
1163311994 19:16520363-16520385 CCTACTCCCGCTCCAGATCTAGG - Exonic
1163510557 19:17732787-17732809 CCCACTCGCCCCCCAGCCCTGGG + Intronic
1164691729 19:30215822-30215844 CCGGCTCACCCTTCAGCTCTAGG - Intergenic
1164790428 19:30972830-30972852 CTTCCTCCCCCTCCTGCTCTCGG - Intergenic
1165472964 19:36014084-36014106 CCTCCTCGGACTCCTACTCTGGG + Intronic
1165551212 19:36587837-36587859 CCCCCATGCCCTCCAGCCCTAGG - Intronic
1165860672 19:38907584-38907606 CGTCCTCGCCCTCGGGCTCAGGG - Exonic
1166213078 19:41319785-41319807 CCTCCTCCTCCTCCTGCTGTTGG - Exonic
1166762694 19:45234746-45234768 GCTCCTCGGCCTCTAGCTCCAGG + Intronic
1166854741 19:45777911-45777933 CCTCTGGGCCCACCAGCTCTGGG + Intronic
1166873583 19:45884601-45884623 CCGCCTCGCCCTCCGGCTCGGGG + Exonic
1166988155 19:46674690-46674712 CCATCTTCCCCTCCAGCTCTCGG + Exonic
1166990951 19:46692468-46692490 CCTGCTCGCCCCCCAACTCTGGG + Intronic
1167149790 19:47702019-47702041 CCTCCACGGCCGCCAGCTCGCGG - Exonic
1167349010 19:48963468-48963490 CCTCCTCTCCCTCCACCTATGGG + Intergenic
925178435 2:1800778-1800800 CCTCATCTCCATCCAGTTCTCGG + Intronic
925528889 2:4837787-4837809 CCCCCTCTTCCTCCCGCTCTTGG - Intergenic
925987851 2:9230638-9230660 CCTCCTCGCCAAGCAGCTCAGGG - Intronic
926185782 2:10689757-10689779 CCCCCTCACTCTCGAGCTCTTGG - Intronic
927007077 2:18861770-18861792 CTTCCTCCCCCTTCAGCCCTGGG + Intergenic
928904420 2:36355600-36355622 CCGCCTCCCCCTCCCCCTCTCGG - Intergenic
929192274 2:39150510-39150532 CCTCCTCACTCTCCAGTTCTTGG - Intergenic
929560344 2:42952694-42952716 CCTCCAGCTCCTCCAGCTCTCGG + Intergenic
929960224 2:46490656-46490678 CCTGCATGCCTTCCAGCTCTGGG + Intergenic
931065576 2:58582380-58582402 CCTCCCCACCCTCCATCTCCAGG + Intergenic
931118925 2:59195328-59195350 CCTCCTATCGCCCCAGCTCTGGG + Intergenic
933250991 2:80028194-80028216 TCTGCTTTCCCTCCAGCTCTGGG + Intronic
933264340 2:80166318-80166340 CCTCCTCTCCCTGAAGGTCTTGG - Intronic
934666406 2:96174335-96174357 CCTCATCACCCTCCTGCTCCTGG - Intergenic
935265230 2:101387693-101387715 CCTCCTCGCGCGCCAGGTCCCGG + Intergenic
935627644 2:105184534-105184556 CCTGCTCGCTCTCCAGCTGACGG + Intergenic
935702575 2:105825100-105825122 CCTCCTCTCCCTCCAGGCTTTGG + Intronic
936080601 2:109430027-109430049 ACTCCTCTCCCTCCTGCTCCTGG - Intronic
936155065 2:110041981-110042003 CCTCATCAGGCTCCAGCTCTGGG - Intergenic
936189617 2:110329433-110329455 CCTCATCAGGCTCCAGCTCTGGG + Intergenic
936522602 2:113220513-113220535 CCACCAAACCCTCCAGCTCTGGG - Intronic
937264463 2:120607224-120607246 CTGCCACGCCCTCCATCTCTTGG - Intergenic
937815220 2:126243799-126243821 CCCCCTTGCCTTCCAGCTTTTGG + Intergenic
942045505 2:172097171-172097193 CCCCTTCACCCTCCTGCTCTCGG + Intergenic
944191574 2:197009725-197009747 CCCCCTCGGCTTCCAGCTCAAGG + Intronic
946081184 2:217119890-217119912 CATCCTAGCCCTCCAGCTGCAGG + Intergenic
946400803 2:219467472-219467494 AGTCCCCTCCCTCCAGCTCTTGG - Intronic
947375451 2:229490562-229490584 CCTCCCCACCCCCCAGCTCTAGG - Intronic
947476043 2:230448616-230448638 CCTCTACTTCCTCCAGCTCTTGG - Intronic
948072600 2:235140024-235140046 CCTCCCCGAACTCCAGGTCTGGG - Intergenic
948283357 2:236765700-236765722 CCACCCTGCCCCCCAGCTCTGGG + Intergenic
948902496 2:240963612-240963634 CCTCGACGCCCTGCAGCTCCTGG - Intronic
1168914006 20:1471789-1471811 CCTTTTCTTCCTCCAGCTCTAGG + Intronic
1169129677 20:3159647-3159669 CCTCGATGCGCTCCAGCTCTGGG + Intronic
1170722482 20:18895930-18895952 CCTTCTCACCCCCCAACTCTGGG - Intergenic
1170857217 20:20068351-20068373 AGTCATCTCCCTCCAGCTCTTGG - Intronic
1170873629 20:20231424-20231446 CCTCCGTGCCCTCCTGCTCCTGG + Intronic
1171381005 20:24734220-24734242 CCACCTCCCCTTCCAGGTCTGGG + Intergenic
1172123069 20:32609785-32609807 CCTACTCGCGCCCCAGCTCAAGG + Intergenic
1172474368 20:35226437-35226459 CCTCTTCCCCCTCCTGCTCAGGG + Intergenic
1172954626 20:38747666-38747688 CCTCCTCTCCCACCCGCTCCTGG + Intergenic
1173647739 20:44644053-44644075 CCTGCTCGCCCTCCAGCAGTTGG - Intronic
1173727616 20:45308330-45308352 CCTCCCCACCCGCCAGCCCTGGG - Intronic
1173927640 20:46792577-46792599 GCTTCTCGTCCTTCAGCTCTGGG + Intergenic
1174130393 20:48340179-48340201 CCACCTGCCCCTCCAGCCCTGGG + Intergenic
1174173738 20:48632374-48632396 CCTCCACGTTCTCCAGCACTGGG + Exonic
1174194516 20:48763602-48763624 ACTGCTCGCCCTCCAGCCCCAGG - Intronic
1174500410 20:50980237-50980259 CCTCCTTTGTCTCCAGCTCTCGG + Intergenic
1175162386 20:57018741-57018763 CCTCCGGGGCCTCCCGCTCTTGG - Intergenic
1175479389 20:59300709-59300731 TGGCCTCGCCCTCCAGCTGTGGG - Exonic
1175502548 20:59460690-59460712 CCTCCTCCAGCTCCAGCTCATGG + Intergenic
1175579689 20:60088693-60088715 CTTCCTTGCCTTCCAGCTTTTGG - Intergenic
1175855109 20:62116922-62116944 CATCCTCCCCATCCAGCTCCTGG + Intergenic
1175873722 20:62220017-62220039 CCTCCCGGCCGCCCAGCTCTCGG - Exonic
1178407777 21:32338609-32338631 GCTCATCTCCCTCCGGCTCTCGG - Intronic
1178881552 21:36454097-36454119 CCTCCAAGGCCTCCAGCTCTGGG - Intergenic
1179491085 21:41741991-41742013 TCTCCTCTCCCTGCAGATCTGGG - Exonic
1179521219 21:41946481-41946503 CTTTCTCCCCCTCCTGCTCTGGG + Intronic
1179928605 21:44552001-44552023 CCTCCCTGTCCTCCTGCTCTTGG - Intronic
1180052030 21:45335703-45335725 CCTCCTCGCCCTCCAGGGACGGG - Intergenic
1180210995 21:46295498-46295520 CCTCCTCTTCCCCCAGCTCTGGG + Intronic
1181312045 22:21950152-21950174 CCTCATTGGCCACCAGCTCTGGG + Intronic
1181425501 22:22835045-22835067 GCTTCTCGGGCTCCAGCTCTGGG + Intronic
1181585255 22:23849534-23849556 CCTCCCTGCCCCTCAGCTCTTGG - Intergenic
1181914588 22:26269423-26269445 CCTTCTCCCACTCCTGCTCTAGG - Intronic
1181941842 22:26483808-26483830 CTACCTCCCCCTCCAGCTCCTGG + Exonic
1182076642 22:27499555-27499577 CCTCCTGGCCCACAAGCTCTCGG - Intergenic
1182176240 22:28292433-28292455 CCACCTCGGCCTCCAACTCCTGG + Intronic
1182217895 22:28734548-28734570 AGTCCTCTCACTCCAGCTCTGGG - Exonic
1182286679 22:29252689-29252711 CCTCCAAGGCCACCAGCTCTGGG - Intronic
1182369385 22:29800223-29800245 CCTCCTCACCCTTTAGCTCTCGG + Intronic
1183033304 22:35121569-35121591 CCTCCTCCTACTCCATCTCTTGG + Intergenic
1183149393 22:36026188-36026210 CCACCTCCACCTCCACCTCTGGG - Intronic
1183545118 22:38451341-38451363 CTTGCTCCACCTCCAGCTCTGGG + Intronic
1183663276 22:39233824-39233846 CCTCCTCGGCCTCCAGGGCGGGG + Intronic
1183931215 22:41237268-41237290 CCTCCTGGAGCTGCAGCTCTCGG - Exonic
1184220225 22:43095146-43095168 CCTCGTCTCCCACCAGCTCTGGG - Intergenic
1184471727 22:44699795-44699817 CCTGCTTGCCCTCCAGCTGCGGG - Intronic
1184799211 22:46749964-46749986 CCTCCTCTCCCTTCATCTCTGGG - Intergenic
1185032173 22:48449876-48449898 CATCCTGGCCCTCCAGCCCTGGG + Intergenic
1185042864 22:48514502-48514524 GCTCCTGGCCCTCCAGAACTTGG + Intronic
1185070696 22:48654224-48654246 CCTCCTCCTCCTCCTCCTCTTGG - Intronic
1185269917 22:49924727-49924749 TCTGCTCTCCCTCCAGCTCCTGG + Intronic
1185333168 22:50260686-50260708 CCTCCTCCCCCTCCACCACCGGG + Intronic
950453422 3:13078521-13078543 CCTCCTCTGCCACCAGCTATGGG + Intergenic
950962515 3:17120595-17120617 CCTCCTCACTCTCTAGCTCATGG + Intergenic
951613997 3:24521940-24521962 GCTCCTCGCCCGCCCGCTCAAGG - Intergenic
951631460 3:24725840-24725862 CCTCTTTGCCCTCCAGGTCCTGG - Intergenic
953042421 3:39267190-39267212 CCCCCTCCCCCTCCTGCTCATGG - Intronic
954638502 3:52084658-52084680 CCCCCTGCCCCCCCAGCTCTGGG + Intronic
954707219 3:52487469-52487491 CCTCCTCCTCCTCCACGTCTGGG - Exonic
954717439 3:52533639-52533661 CGTCCTCGCCCTCCTGCCCTGGG - Exonic
955201854 3:56858788-56858810 CCTCCACCCTCTCCATCTCTTGG - Intronic
957589385 3:82175470-82175492 CCCCCATTCCCTCCAGCTCTTGG + Intergenic
961290200 3:125840664-125840686 CCACCTGGCCCTCCAGCTGCAGG - Intergenic
961446565 3:126983999-126984021 CCTCCTTGGCCTCCCCCTCTCGG + Intergenic
961541693 3:127604623-127604645 CCTCATAGGCGTCCAGCTCTGGG - Exonic
961591148 3:127982779-127982801 CTCCCTCGCCTTCCAGGTCTAGG + Intronic
961718542 3:128876035-128876057 TCTCCTCTTCCCCCAGCTCTAGG + Intergenic
962557730 3:136572515-136572537 CCTCCTCAACCTCCACCTCCTGG - Intronic
968064899 3:195753224-195753246 CCTACTCACTCTGCAGCTCTGGG - Exonic
968500921 4:949707-949729 GGCCCTCGCCCTCCAGCCCTGGG - Intronic
968605237 4:1532272-1532294 CCTCCTGGCCCACCAGCCCTCGG - Intergenic
968657782 4:1786056-1786078 CCACCTCTGCCTCCAGCTCTCGG - Intergenic
972412949 4:38811191-38811213 CCTCCTCTGCCTCAAGGTCTTGG + Intronic
972565436 4:40265162-40265184 CCTGCTCGCCCTCAGGCACTAGG - Intergenic
972565481 4:40265370-40265392 CCTCATCACCCTGCAGCTGTGGG + Intergenic
973621507 4:52731080-52731102 CCTGCTCCCCCCCCAGCCCTGGG + Intronic
974092436 4:57325929-57325951 ACTCCTCACTCTCCAGCTATTGG + Intergenic
975824813 4:78308481-78308503 GCTCCTTTCCCTCCAGCTGTGGG - Intronic
975905898 4:79211630-79211652 CCTTCTGGCCCTCCAGCTTGTGG - Intergenic
978935465 4:114369645-114369667 CCTCTTCTCTCTACAGCTCTTGG + Intergenic
979266569 4:118710168-118710190 CCACCTCTTCCTCCACCTCTGGG - Exonic
982046187 4:151448470-151448492 CCCCCTTGGCCTCCAGCTCCTGG + Intronic
982309010 4:153964462-153964484 CCTCCTCGGCCTCCTGATCCAGG - Intergenic
983329433 4:166305593-166305615 CCTCCTCTTCTTCCAGTTCTCGG - Intergenic
984185315 4:176536477-176536499 CTTCCTGGCCCTGCAACTCTGGG - Intergenic
984979933 4:185270685-185270707 CCTTCCCTCCCTCCAGCCCTTGG + Intronic
985532738 5:443404-443426 CCTCCCCGCCCTCCAGGTCCCGG - Intronic
985549923 5:527986-528008 CCTGCAGGCCCTCCAGCTCCAGG - Intergenic
985695681 5:1338826-1338848 CCCCCCGGCGCTCCAGCTCTGGG + Intronic
985749333 5:1665443-1665465 CCGCCTGGCCCTGCAGCTGTAGG + Intergenic
986115588 5:4770773-4770795 CATTCTCACCCACCAGCTCTGGG + Intergenic
986125988 5:4882725-4882747 CAGCCTGGCCCTCCAGCCCTGGG - Intergenic
986638768 5:9850903-9850925 CCCCCTCCCACTCCAGGTCTGGG - Intergenic
987206796 5:15635614-15635636 CCTAAGCTCCCTCCAGCTCTAGG - Intronic
987234313 5:15927986-15928008 CCTCCTCGTCCTCCATCACCGGG + Exonic
987313361 5:16701409-16701431 CCTCATCGACCTCCTCCTCTGGG + Exonic
989048264 5:37294826-37294848 CCTTCACACCCTCCAGCCCTAGG - Intronic
990114077 5:52367397-52367419 CCTCATCCCCCTCAAGCCCTAGG - Intergenic
992093399 5:73339164-73339186 CCCTCCTGCCCTCCAGCTCTGGG - Intergenic
992732858 5:79689976-79689998 CCTCCTCGGTCTCCAGCTCCCGG - Exonic
992772297 5:80059945-80059967 CCTCCTCACCCTGCAGCTTTTGG + Intronic
992910865 5:81394393-81394415 GTTCCTCGCGCTCCGGCTCTCGG - Intergenic
998157657 5:139795767-139795789 CCTCCTCCTCCTCCAGCTCACGG + Intergenic
999132897 5:149298136-149298158 CCTCCAGGCCCTGCAGCTCCGGG + Intronic
999541358 5:152576012-152576034 CCTCCTCACCATTTAGCTCTAGG - Intergenic
1001906222 5:175475840-175475862 CCTCCTGGGCTTCCAGCTATGGG - Intergenic
1002322301 5:178383143-178383165 CCTCCCCCTCCTCCAGCTCTGGG + Intronic
1002352341 5:178591863-178591885 CCTCCTCATCCTCCAGGTCAAGG + Intergenic
1003224434 6:4191374-4191396 CCTCCCCGCCCTCCTGCCGTGGG - Intergenic
1003514606 6:6807587-6807609 CTTGTTCTCCCTCCAGCTCTAGG + Intergenic
1003616289 6:7657989-7658011 CCTCCTATCCCTGCACCTCTGGG - Intergenic
1004304823 6:14490657-14490679 TCTTCTCTCCCTCCAACTCTTGG - Intergenic
1004924612 6:20404165-20404187 CCCCCTCCCCCTCCAGCACAAGG - Intronic
1006320308 6:33315947-33315969 CCTCTTCCTCCTCCAGATCTGGG + Exonic
1006415517 6:33901580-33901602 CCTCCTCTCCCACCAGCTCATGG - Intergenic
1006515028 6:34541071-34541093 GCTCCTTGCCCGCCAGCTCCTGG + Exonic
1007250812 6:40493638-40493660 CCTCCTGCACCTCCATCTCTTGG + Intronic
1007414995 6:41686350-41686372 CCACCTCCACCTCCAGGTCTGGG - Intronic
1007731689 6:43951387-43951409 CCTGCTCACCCTTCACCTCTGGG - Intergenic
1007763944 6:44150208-44150230 GCTCCCCTCCCTCCAGCTCTGGG + Exonic
1008171522 6:48213644-48213666 CCTCCACGGCCACCACCTCTTGG + Intergenic
1008637227 6:53423091-53423113 CCCCCTTGCTCTCCAGCTTTTGG + Intergenic
1013292611 6:108732319-108732341 CAGCTTCGCCCTCCAGCTGTTGG + Intergenic
1013978570 6:116103489-116103511 CCTCCTCACCTGCCAGCTCCCGG - Intronic
1014273153 6:119356736-119356758 CCTCCTATCCCTCCAGCCCAAGG - Intergenic
1014340340 6:120197655-120197677 CCTCCTCCTCCTCAAGCTCTGGG + Intergenic
1016028328 6:139311850-139311872 CATCCTAGCCCCCCTGCTCTCGG - Intergenic
1016325452 6:142896279-142896301 CTTCCTCCTCCTCCTGCTCTGGG + Intronic
1016461635 6:144285224-144285246 CCTCCTCCGCCTCCAGCGCTCGG + Intergenic
1016629691 6:146213954-146213976 ACTCCAGGCCCTCCAGCTTTTGG - Intronic
1019284826 7:218268-218290 GCTCCTCGCCCTGCAGGCCTGGG + Intronic
1019327500 7:445609-445631 CGTCCTCGTCCTCCAGCTCTTGG + Intergenic
1019531080 7:1503871-1503893 CCTCCTCGCTCTGCAGCCCGGGG - Intronic
1019547459 7:1585398-1585420 CCTTCCCGGCCACCAGCTCTCGG + Intergenic
1019626558 7:2018821-2018843 CCTCCGCCCCCTCCAGCCCAAGG + Intronic
1020727380 7:11832288-11832310 CCTCCTCCCCCTCCAGCTGGCGG - Intergenic
1022443615 7:30452615-30452637 CCTCCTCGGGGTCCCGCTCTGGG + Exonic
1022815058 7:33905458-33905480 CCCCCCCGCCCCCCAGCTCTCGG + Exonic
1023279588 7:38555957-38555979 CCTCCTTCCCCACAAGCTCTAGG - Intronic
1023910653 7:44553322-44553344 CCTCCTCCCCCTCCTCCTGTTGG - Intergenic
1024507586 7:50175356-50175378 CCTCCCTGGCCTCCAGGTCTGGG - Intergenic
1026744133 7:72998079-72998101 CCTCCTGGCACTCCAGACCTGGG - Intergenic
1027030240 7:74882756-74882778 CCTCCTGGCACTCCAGACCTGGG - Intergenic
1027099604 7:75367013-75367035 CCTCCTGGCACTCCAGACCTGGG + Intergenic
1027584847 7:80045003-80045025 CCTCCTAGGCCTCCAGGCCTGGG + Intergenic
1028373434 7:90119636-90119658 CCTCCTCTACCTCCGGCTCCGGG - Intergenic
1028752786 7:94400262-94400284 CCTCCTGGCCCCCCTGGTCTCGG + Exonic
1029123703 7:98283893-98283915 CCTCGGCGCCCCCCAGCCCTGGG - Intronic
1029378851 7:100199525-100199547 CCTCCTGGCACTCCAGACCTGGG + Exonic
1029459262 7:100686013-100686035 CCTCCTCCTCCTCCAACCCTTGG + Exonic
1029493404 7:100884411-100884433 CCTCCTCCTCCTCCTGCTCCAGG - Exonic
1029587873 7:101486967-101486989 CTTCCTCCCCCTCCAGCCCTGGG - Intronic
1030338591 7:108351461-108351483 CCTCCTGGCCCTCCAGAGTTTGG - Intronic
1032062944 7:128739711-128739733 CGTCCTGGTCCTCCATCTCTAGG + Intronic
1033273123 7:139950681-139950703 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273132 7:139950705-139950727 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273141 7:139950729-139950751 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273150 7:139950753-139950775 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273159 7:139950777-139950799 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273176 7:139950825-139950847 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273185 7:139950849-139950871 CCCCCTCGCCCTCCATCTACGGG + Intronic
1033273193 7:139950873-139950895 CCCCCTCGCCCTCCATCTACAGG + Intronic
1033312397 7:140271431-140271453 CCTCAGCGCCCTCCAGCCATGGG - Intergenic
1033484819 7:141778192-141778214 CCCTCTCGCCCTCCTGCTCTTGG + Intronic
1034255927 7:149724672-149724694 CCTCCTCCCCATCCTGATCTTGG + Exonic
1034505602 7:151487331-151487353 CAACCTCTCCCCCCAGCTCTGGG - Intronic
1035017624 7:155780651-155780673 GCTCCTCTCCCTCCACCTCCTGG + Exonic
1035349864 7:158238304-158238326 CCTCCCCTCCCTCCTGCCCTGGG + Intronic
1035626790 8:1076828-1076850 CCTCCTCCCCCTCTTGGTCTTGG - Intergenic
1035626837 8:1076950-1076972 CCTCCTCCCCCTCTTGGTCTTGG - Intergenic
1036617600 8:10400595-10400617 CCTCCATGCCCTACATCTCTCGG - Intronic
1037271362 8:17134223-17134245 CCACCTCCCCCTGCAGATCTTGG - Intergenic
1037294549 8:17386583-17386605 GCTCCTCACCCTCAAACTCTTGG + Intronic
1037300086 8:17442501-17442523 CCTCTTCTCCCTCTAGCCCTAGG + Intergenic
1037682368 8:21108196-21108218 CCTCCTCCCTCCCCAGCTCTGGG + Intergenic
1037948016 8:23001211-23001233 CCTCCTCACCACCCAGCCCTGGG - Intronic
1038483833 8:27919741-27919763 CCTCCTGGCCCTGCGGCTGTGGG + Intronic
1038484848 8:27927228-27927250 CCTCCTCACTTACCAGCTCTGGG + Intronic
1039108492 8:34016092-34016114 ACTCCTTGCCCTTCAGATCTGGG + Intergenic
1039893463 8:41699706-41699728 AGTCCTGGTCCTCCAGCTCTGGG + Intronic
1040652488 8:49464892-49464914 CCACCGCGCCCTGCAGCTCTCGG - Intergenic
1044290411 8:90462353-90462375 CCTCTTCGTCCTTCAGATCTGGG + Intergenic
1044416289 8:91944041-91944063 CCTCCTTTCCTTCCACCTCTAGG - Intergenic
1044698759 8:94948740-94948762 CCTCCTCCTCCGCCTGCTCTCGG - Intronic
1047962049 8:130017645-130017667 CCACCTCCACCTCCAGCTATAGG + Intergenic
1048050710 8:130813389-130813411 TCTCCCCTCCCTCCAGCCCTTGG + Intronic
1048490527 8:134888070-134888092 CCACCTCGCCCTCCAGGCCCCGG + Intergenic
1049106255 8:140615382-140615404 ACTCCTTGCCCACCTGCTCTAGG + Intronic
1049114503 8:140674359-140674381 CCGCCTCGCCCTGGAGCTCCCGG - Exonic
1049157250 8:141074727-141074749 CCTCCAAGCCCTCCTGCACTGGG + Intergenic
1049252516 8:141596853-141596875 CCTGCTCTCCCTCCAGCTTGGGG + Intergenic
1049386822 8:142347087-142347109 CACGCTCACCCTCCAGCTCTGGG + Intronic
1049643846 8:143727486-143727508 CCTCCGGGCCCTCGCGCTCTGGG + Exonic
1049939583 9:532536-532558 CCTCCACTCCCTCCAGCCCCTGG + Intronic
1050022094 9:1294762-1294784 CCTCCCAGCTCTCAAGCTCTAGG + Intergenic
1050959255 9:11706367-11706389 CCTCCTCGGCCTCCAAAGCTGGG - Intergenic
1051148696 9:14058021-14058043 CCTCCTTTACCTTCAGCTCTGGG - Intergenic
1052978431 9:34429408-34429430 CCTCCTCACTCACCAGCTCAGGG + Intronic
1054764958 9:69035741-69035763 CCGCTCCGCCCTCCAGCGCTGGG - Exonic
1055961252 9:81822330-81822352 CCTTCTCCCCCTCCACCTTTGGG + Intergenic
1056068222 9:82958834-82958856 CCTCCTCTGCCTCCACATCTTGG + Intergenic
1057798301 9:98173608-98173630 CCTCCTCGTCCTCCTTCTCATGG + Intronic
1057866507 9:98686137-98686159 CCTCATCCCCCGCCAGCTCCAGG + Intronic
1058874026 9:109226394-109226416 CCCCTTGTCCCTCCAGCTCTAGG + Intronic
1058972962 9:110099937-110099959 CCCCCTCCCCCTCCAGCTCTCGG - Intronic
1061196129 9:129108211-129108233 CCTCCCAGCCCTAGAGCTCTAGG + Intronic
1061262090 9:129486090-129486112 CAGCCTGGCCCGCCAGCTCTGGG - Intergenic
1061387931 9:130301433-130301455 CTTCCCCGCCCTCCAGGTCTGGG + Intronic
1061495127 9:130969318-130969340 CCTCCTTTCCCTCCAGCCCCTGG - Intergenic
1061854982 9:133437036-133437058 CCTACTATCCCTCCAGCACTGGG + Intronic
1062308626 9:135923621-135923643 CCTCCTCTCCCTCCAGTCCTGGG + Intergenic
1062424161 9:136498328-136498350 CATCCTGGCCCTGCAGCTCCTGG - Intronic
1062572622 9:137192607-137192629 CCACCTCTTCCTCCTGCTCTAGG + Exonic
1062583454 9:137238226-137238248 CCTCCTCCTCCTGCAGCTGTCGG - Intergenic
1062631290 9:137464271-137464293 CCTCCTGGCCCCCCACCTCTTGG - Intronic
1062670460 9:137705880-137705902 CCTCCTCTCCCCACAGCTCTGGG + Intronic
1185480069 X:439264-439286 CCTCCTCCAACACCAGCTCTGGG - Intergenic
1186510833 X:10128661-10128683 CCTCCTTGCGCTCCATCTCCAGG - Exonic
1186861319 X:13675157-13675179 CCACCTCGGCCTCCAGTGCTGGG - Intronic
1187038027 X:15563293-15563315 CTGCCTCGCCCTCCAGTGCTGGG - Intronic
1187665960 X:21609544-21609566 CCTCCTCTTCCTCCACCTCTGGG - Exonic
1188721606 X:33529141-33529163 CCTCCTAGTCCTCTGGCTCTGGG + Intergenic
1189179564 X:38990623-38990645 CCTCCTCCCCTCCCAGCTCCTGG - Intergenic
1189215233 X:39317359-39317381 CCTCCCTTCCCTCCACCTCTTGG + Intergenic
1190929070 X:54933350-54933372 CCTCATCGCCTTCCACCTTTAGG - Exonic
1190984524 X:55488898-55488920 CTTCTTTGCCCTCCGGCTCTGGG - Exonic
1191892253 X:65956329-65956351 CCTCCACGGCCACCACCTCTTGG + Intergenic
1192432712 X:71123290-71123312 CCTCCACCACCTCCATCTCTCGG - Intronic
1192875137 X:75222210-75222232 CCTCCTCCTCCCCTAGCTCTAGG - Intergenic
1195284250 X:103367795-103367817 CATCCTCTCCCTCCAGCTGCCGG - Intergenic
1196016487 X:110945031-110945053 CCTCCTCAGCTTCCAGCTCCAGG + Intronic
1196148210 X:112343024-112343046 CCTCCACCTCCTCCACCTCTCGG - Intergenic
1197861395 X:130974587-130974609 CTTCCTCTCCCTTCAGCTCCCGG - Intergenic
1198462156 X:136874182-136874204 CCTCCACGGCCACCACCTCTTGG + Exonic
1200164145 X:154024487-154024509 CCTGGTCGCCTTCCACCTCTGGG - Intronic
1200250873 X:154553039-154553061 CCGCCCCTCCCTGCAGCTCTGGG - Intronic
1200259105 X:154602510-154602532 ACTCCTCGCCTTAGAGCTCTGGG - Intergenic
1200292196 X:154885250-154885272 CCTCGTTGCCCGCCAGCTCCGGG - Exonic
1200304210 X:155008321-155008343 CCGCCCCTCCCTGCAGCTCTGGG + Intronic
1200339034 X:155380987-155381009 CCTCGTTGCCCGCCAGCTCCAGG - Exonic
1200347435 X:155459705-155459727 CCTCGTTGCCCGCCAGCTCCAGG + Exonic
1201464128 Y:14261228-14261250 CTTCCTCCACCTCCAGCTCCTGG + Intergenic
1201906784 Y:19093558-19093580 CCTCCTCCATCTCCAGCTCCTGG + Intergenic