ID: 1066220839

View in Genome Browser
Species Human (GRCh38)
Location 10:33335426-33335448
Sequence CCCTCCTCGCCCTCCAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 435}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220839_1066220846 -3 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220846 10:33335446-33335468 GGGGAAAGCCGGGCTGGAGTGGG No data
1066220839_1066220853 24 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220853 10:33335473-33335495 GCACCGCGAAGCCGGGCGAGGGG No data
1066220839_1066220845 -4 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG No data
1066220839_1066220852 23 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220852 10:33335472-33335494 CGCACCGCGAAGCCGGGCGAGGG No data
1066220839_1066220848 16 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220848 10:33335465-33335487 TGGGAGCCGCACCGCGAAGCCGG No data
1066220839_1066220851 22 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220851 10:33335471-33335493 CCGCACCGCGAAGCCGGGCGAGG No data
1066220839_1066220849 17 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220839_1066220844 -9 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220844 10:33335440-33335462 CGAGGAGGGGAAAGCCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220839 Original CRISPR CCCTCCTCGCCCTCCAGCTC TGG (reversed) Intronic
900100511 1:960276-960298 CCCTCCTCCTCCTCCTCCTCCGG - Intergenic
900512354 1:3066702-3066724 CCTGCCTCCTCCTCCAGCTCAGG - Intergenic
900592279 1:3465429-3465451 CCCCCTTCGGCCTCCAGGTCTGG - Intronic
901062488 1:6478492-6478514 CTCACCTCACCCTCCAGCTACGG + Intronic
901537421 1:9891547-9891569 CCCTCCTCACCACCCGGCTCTGG + Intronic
901839480 1:11944883-11944905 CCCTCCCCTCCCACCACCTCAGG - Intronic
902377232 1:16035502-16035524 AGCTCCTCGCCCTCCCTCTCTGG + Intergenic
902621970 1:17655999-17656021 TCCGCCTCCTCCTCCAGCTCCGG - Exonic
903036548 1:20496684-20496706 CCCTCCACTTCCTCCTGCTCCGG + Intergenic
903107871 1:21100191-21100213 CCCACCTCTCCCTTCAGCTTAGG - Intronic
903808527 1:26021963-26021985 CCCTCCTGGCCCTCCAAGGCAGG + Exonic
904319802 1:29689478-29689500 CCCTCCCAGCCCTCCTGCTGGGG + Intergenic
904328233 1:29741310-29741332 CCCTCCGCACCCCCCAGCTCGGG + Intergenic
904353572 1:29924401-29924423 GCCTGCTAGCCCTCCTGCTCAGG - Intergenic
904478534 1:30779724-30779746 CCCTCCCCACCCTCAAGCCCAGG + Intergenic
906078294 1:43068036-43068058 CCCTCCTCCCCATCCAGCCTCGG + Intergenic
906153810 1:43602573-43602595 CCCTGGTATCCCTCCAGCTCTGG - Intronic
906403392 1:45521955-45521977 CCCTCCTCTCTCTCCTCCTCCGG - Intronic
906558521 1:46735431-46735453 CCCTCCACGCCCTCAAGCTGGGG - Intergenic
906609357 1:47191040-47191062 TCCACCTGGCCCTCCAGCTCAGG + Intronic
907191933 1:52656891-52656913 CCCTCATTGCTCTCCAGCTGCGG - Exonic
907757565 1:57325649-57325671 CACTTCTCCTCCTCCAGCTCTGG + Intronic
907933411 1:59020579-59020601 CCCTTCTCCCTCTACAGCTCTGG + Intergenic
909242395 1:73230838-73230860 CCCTCCTCGCTCTTAAGTTCTGG - Intergenic
912382522 1:109255096-109255118 TCCTCCTGGCCCGGCAGCTCTGG + Intronic
912543820 1:110436749-110436771 CCCTCCTTTCCCGCCAACTCTGG + Intergenic
913250681 1:116910127-116910149 TCCTCCTCCTCTTCCAGCTCCGG - Exonic
913252685 1:116924985-116925007 CCCACCTCAGCCCCCAGCTCAGG - Intronic
915574679 1:156767826-156767848 GCCTCCTCTTCCTCCGGCTCGGG - Exonic
917305208 1:173617428-173617450 CCCTTCTAGCCTTCCAGCTCTGG + Intronic
917359372 1:174159531-174159553 CCCTCCTCGGGCTCCAGCGGTGG + Exonic
917802994 1:178587238-178587260 CCCCCCTCTCTCTGCAGCTCTGG + Intergenic
918263736 1:182820666-182820688 ACTTCCTCTCCCTCCTGCTCTGG - Intronic
919929515 1:202212282-202212304 CTCTGCTCGCCCTCCATCACTGG - Intronic
919989623 1:202700210-202700232 CCCTCCACCCCGTGCAGCTCTGG + Intronic
920051449 1:203167171-203167193 CCCGCCTCGCCCTCCCACACAGG - Exonic
920051463 1:203167207-203167229 CCCGCCTCGCCCTCCCACACAGG - Exonic
920235411 1:204500084-204500106 CCATTCACCCCCTCCAGCTCAGG - Intergenic
920283249 1:204859865-204859887 CCCTTGGCGCCCTCCAGCTTAGG - Intronic
921326123 1:213987724-213987746 CCCTCCCCGGCCTCCATCCCCGG - Intronic
922712867 1:227846133-227846155 CCCTGCTCTCTCTCCAGCTCTGG + Exonic
1064564249 10:16624150-16624172 ACTTCCCCGCCCTCTAGCTCAGG + Intronic
1065249200 10:23793465-23793487 CCCTCCTTGTCTTCCAGTTCTGG + Intronic
1065787188 10:29227511-29227533 CCCTCCCCGCCCACCAACACTGG + Intergenic
1065972807 10:30818538-30818560 CCCTCCTCCCCCGCCACCTCTGG - Intergenic
1066220839 10:33335426-33335448 CCCTCCTCGCCCTCCAGCTCTGG - Intronic
1067053407 10:43038043-43038065 CACTCCTAGGCCTCCAGCTGTGG - Intergenic
1067830772 10:49610114-49610136 CCTTCCTGGGCCTCCAGCCCTGG + Intronic
1068549111 10:58385875-58385897 CCCTCCTCACTGTCCAGCTTTGG + Intronic
1069474628 10:68721589-68721611 CCCTCCTGGCCCCCCGGCCCGGG + Intronic
1069680854 10:70284095-70284117 CCCTCCTCCCACTGCAGCCCTGG + Intergenic
1069724128 10:70566629-70566651 TCCTCCCCGCTCTCCAGCTCGGG - Exonic
1072781166 10:98252758-98252780 CCCGCCTCTCCCCCCAGTTCAGG - Intronic
1072807211 10:98431182-98431204 GCCTCCTCGCCTCCCCGCTCGGG + Exonic
1073586078 10:104711556-104711578 CCTTCCTAGCAATCCAGCTCAGG + Intronic
1074153780 10:110781363-110781385 CCATCCTCGGCCTCAACCTCGGG + Exonic
1075128382 10:119719397-119719419 CACTCCTCGCTCTCCTGCCCAGG + Intergenic
1075951242 10:126479450-126479472 AGCTCCTCGCCCTCCGGATCTGG - Intronic
1076035682 10:127196703-127196725 TCCTCCTCCTCCTCCAGCTCTGG - Intronic
1076138338 10:128060378-128060400 CTGTGCTCGCCTTCCAGCTCTGG + Intronic
1076569058 10:131420423-131420445 CCCTCCTCTTCCTCCTGCTGAGG + Intergenic
1076713784 10:132353154-132353176 TCCTCCTCGACCTCCTGCTGGGG - Intronic
1077044080 11:536819-536841 CCCGCCTCGCCCTCCTGCGCCGG + Intronic
1077093583 11:790128-790150 CCCTCCCCGCCCTCCTGCGCCGG - Intergenic
1077305834 11:1868365-1868387 CCCTCCATTCCCTCCATCTCGGG + Intronic
1077442217 11:2574162-2574184 CCCACCTGGCCCTGCAGCTGTGG - Intronic
1077479585 11:2807439-2807461 GCCTCCTCGCCCCCCCACTCCGG + Intronic
1078020853 11:7654959-7654981 CCCTCCTGCCCCTCCTTCTCAGG - Intronic
1078188770 11:9074664-9074686 CCCACCTCACCCAGCAGCTCAGG + Intronic
1078543740 11:12231344-12231366 TCCTCCTCCTCCTCCAGCACTGG + Intronic
1079539859 11:21560275-21560297 CCCTCTGGGCCCTCCTGCTCTGG + Exonic
1079587290 11:22141878-22141900 CCCTCCTCAACCTCCATCTCTGG - Intergenic
1081488256 11:43547894-43547916 CCCTTCTCTTCCCCCAGCTCGGG + Intergenic
1081910387 11:46696392-46696414 CCCTCCAGGCCCTGCAGCTGGGG + Intronic
1083618056 11:64036048-64036070 CCCTGGGCGCCCTCCGGCTCTGG + Intronic
1083629976 11:64090466-64090488 TCCTCCTCCTCCTCCACCTCAGG - Intronic
1084517069 11:69642918-69642940 CCCTCGGCGCCCTCCAGACCTGG + Intronic
1084680763 11:70664932-70664954 GACTCCACGGCCTCCAGCTCAGG - Intronic
1084742108 11:71146588-71146610 TCCTCCTGTCCCTCCAGCCCTGG - Intronic
1084956940 11:72696636-72696658 TCCTCCTCGTCCTCAATCTCTGG + Exonic
1085742487 11:79089061-79089083 CCCTGGTCTTCCTCCAGCTCTGG + Intronic
1089066113 11:115663210-115663232 CTCTCCTTGCCCAGCAGCTCTGG - Intergenic
1089280519 11:117371155-117371177 CCCTGCAAGCCCTCCAGCCCAGG + Exonic
1089303402 11:117512283-117512305 CCCTTCTCCCCCTCCAAGTCAGG + Intronic
1089317320 11:117600861-117600883 CCCTCCTTCTCCTCCAGCTCTGG - Intronic
1089324345 11:117647139-117647161 CCCCTCTCCACCTCCAGCTCTGG - Intronic
1089341278 11:117759464-117759486 CCCTGCTTGCCTTCCAGCCCTGG - Intronic
1089525267 11:119093025-119093047 ACCCCCTCGCCCTCCAGCTTTGG - Intronic
1089853757 11:121522629-121522651 AGCTCCTCAACCTCCAGCTCCGG + Exonic
1089912976 11:122121993-122122015 TCCATCTCTCCCTCCAGCTCTGG - Intergenic
1090363166 11:126187122-126187144 CCCTCCTTGCCCTCCCACACAGG + Intergenic
1090451714 11:126811964-126811986 CCCTCCCCGTCCCCCAGCACTGG + Intronic
1091003917 11:131934771-131934793 CTCTTCTCTCCCTCCAGCACCGG - Intronic
1091558598 12:1594202-1594224 CCCTCCCCGCCTTCCGGCTCCGG + Intronic
1091746802 12:2998000-2998022 TCCTCCCCGCCCTCCAGCCCTGG + Intronic
1091793756 12:3285956-3285978 CCCCCCTCTCCCTCCAGCATGGG + Exonic
1094687187 12:32729413-32729435 CCCTCTCCTCCCTCCAGCCCTGG + Intronic
1095956913 12:47812171-47812193 CCCTCCTCGCCCTGCCTCACTGG + Intronic
1096149145 12:49297770-49297792 CCCTCCTCGGGCTCTTGCTCTGG + Intronic
1096245252 12:49981301-49981323 GCCTCCTCCACCTGCAGCTCTGG - Intronic
1096372895 12:51083467-51083489 CCCTCCCCGCCCTGCCGCCCTGG - Exonic
1096599873 12:52721668-52721690 TCCTCCTTTGCCTCCAGCTCAGG - Intergenic
1096675932 12:53225892-53225914 TCCTCCTCTCCCTGCAGGTCTGG - Intronic
1096863942 12:54550029-54550051 CCCCCCTCCTCCTCCCGCTCAGG - Intronic
1097029319 12:56080134-56080156 CCCTCCCCGGACTCCGGCTCCGG + Exonic
1099969671 12:89487796-89487818 CCCTTCTCTCCCCTCAGCTCTGG + Intronic
1099972448 12:89514231-89514253 CCCTTCTCTTCCTCCAGCTCTGG + Intronic
1100365242 12:93914562-93914584 CCCTCCTTGCCCTCCCCTTCTGG - Intergenic
1100384339 12:94091686-94091708 CCCTCCTGGCCCTCCACCCCAGG - Intergenic
1100391400 12:94148710-94148732 TCCTCCTCGCCCTCCTTCGCCGG - Exonic
1102000428 12:109554385-109554407 GCCTCCTCCGCCTCCAGGTCAGG - Exonic
1102495588 12:113316809-113316831 CCCACCTCTCACTGCAGCTCAGG - Intronic
1103410196 12:120705956-120705978 CCTTCCTTTCCCCCCAGCTCAGG - Intergenic
1103721804 12:122979263-122979285 CCCTCATCGTCCACCAGGTCGGG - Exonic
1103921692 12:124402643-124402665 TCCTCCTCCTCCCCCAGCTCAGG - Intronic
1104188692 12:126457563-126457585 CCCTCTTGGCCCTCCAGCACTGG + Intergenic
1104248114 12:127062250-127062272 CCTGCCTCTCCCTCCATCTCTGG + Intergenic
1104387819 12:128366126-128366148 GCCTGCTCGGCCTCCAGCCCAGG + Intronic
1104602316 12:130162227-130162249 CCCGCGTCGCCCGCCAGCCCCGG - Intergenic
1105255161 13:18739454-18739476 CCCTCCTAGCCCCACAGCACAGG - Intergenic
1105405492 13:20128882-20128904 CACTCCACCCCCTCCAGCTGTGG + Intergenic
1108696214 13:52904656-52904678 CCCTCCCTGCTCTCCGGCTCTGG - Intergenic
1109799854 13:67362524-67362546 GCCCCCTCTCCCTCCTGCTCTGG - Intergenic
1112194453 13:97211360-97211382 CCCTCGTCTCTCTCAAGCTCAGG - Intergenic
1112507779 13:99985353-99985375 TCCTCCCCGGCCGCCAGCTCCGG + Exonic
1112508148 13:99987849-99987871 CTCTCCTTTCCCTCCAGCCCTGG + Intergenic
1112569260 13:100579305-100579327 CCCTCCTCTCCCCACAGCTGTGG - Intronic
1113799087 13:113077321-113077343 GCCTCCTCCCCTTCCACCTCCGG + Intronic
1113814683 13:113162389-113162411 CCCTCATCCTCCTCCTGCTCAGG + Intronic
1113814752 13:113162599-113162621 CCCTCATCCTCCTCCTGCTCAGG + Intronic
1114269022 14:21090391-21090413 CCCGCCGCGCCTTCCACCTCTGG + Exonic
1115729971 14:36258110-36258132 CCTTCTTCACCCTCCAGATCTGG - Intergenic
1119160327 14:72447025-72447047 CCCACCTCTTCCTCTAGCTCAGG - Intronic
1119224520 14:72934626-72934648 CCCTCCCCCACCTCCAGCCCAGG + Intronic
1120766017 14:88326853-88326875 CCCTCCCCACGCTCCAGCCCGGG + Intronic
1121121446 14:91378251-91378273 ACCCCCTGTCCCTCCAGCTCAGG - Intronic
1121303452 14:92890089-92890111 CCCTCCACTGCCTCCAGCTCTGG + Intergenic
1122066072 14:99175226-99175248 TCCTCCTCGTCCTCCTCCTCCGG + Exonic
1122637681 14:103138081-103138103 CCCTCCCCCACCCCCAGCTCCGG - Intergenic
1122916935 14:104863806-104863828 CCCCCCCCGCCCTCCAGCCCAGG + Intergenic
1124096812 15:26656245-26656267 CTCTCATTTCCCTCCAGCTCCGG + Intronic
1126188353 15:45853068-45853090 CACTCCTGCCCCTCCAGCTTTGG - Intergenic
1127273127 15:57418847-57418869 CCCGACTCACCCGCCAGCTCTGG - Intronic
1127903984 15:63362513-63362535 TTCTCCACTCCCTCCAGCTCTGG - Intronic
1128086243 15:64888606-64888628 CCCTCCTGGGCCTCCAGGCCTGG - Intronic
1128090471 15:64915635-64915657 CCCTCCTCCCTCTCAAGGTCAGG - Intronic
1128265881 15:66266287-66266309 CCCTTCTGGGCCTCCAGCTGAGG - Intergenic
1129518478 15:76171100-76171122 CCCTCTTCACCCTCCAGATCCGG - Exonic
1129691414 15:77715796-77715818 CCCTCCTCTCCATTCATCTCAGG + Intronic
1129853581 15:78809731-78809753 TCCTCCTCAGCCCCCAGCTCTGG + Intronic
1130231305 15:82099383-82099405 CCCTCCTCACCCTCTTCCTCAGG + Intergenic
1130551997 15:84895197-84895219 CCTTCCTCCTCCTCCAGCCCTGG - Intronic
1131144019 15:90000361-90000383 GCCTCGCCGCCCTCCAGCTCCGG - Intergenic
1131166511 15:90145647-90145669 CTCCCCTCTCCCACCAGCTCTGG - Intergenic
1131268788 15:90934322-90934344 CCCACCTCTCTCTTCAGCTCTGG + Intronic
1131446330 15:92500636-92500658 CCGACCTCGCCCTTCAGATCGGG + Exonic
1131573006 15:93558216-93558238 TTCTCCTCTCCCTCCACCTCTGG - Intergenic
1132366650 15:101262541-101262563 CCCACCTCCACCTCCAGCTCAGG + Intergenic
1132683338 16:1152712-1152734 CGCCCCTCCCCCTCCCGCTCCGG - Intergenic
1132889413 16:2196567-2196589 CCCTCCTCGGGCTCCGGCTTGGG + Intergenic
1132915243 16:2340477-2340499 CCACCCTCGCCGGCCAGCTCGGG - Intronic
1132936449 16:2483696-2483718 GCCTCCTCTCTCTCCAGCTCAGG - Intronic
1133230189 16:4362680-4362702 CCCTCCACGCCCTCCAGCCTGGG - Exonic
1133316939 16:4890785-4890807 GCCTCCTGGCGCTCCAGGTCCGG + Exonic
1134260794 16:12649355-12649377 CCCTCCCCAGCCTCTAGCTCTGG + Intergenic
1135423736 16:22322172-22322194 CCCTCCTCCTCCCCCTGCTCAGG - Intronic
1135424439 16:22325349-22325371 CCCTCCACCCTCTCCAGGTCCGG - Intronic
1136220484 16:28824467-28824489 CCCTCTTCGCCCTCAACCGCCGG + Intronic
1136428323 16:30183669-30183691 TCCTCCTCCTCCTCCACCTCCGG + Exonic
1136549580 16:30975811-30975833 TCTTGCTCTCCCTCCAGCTCTGG - Intronic
1136922800 16:34345888-34345910 CCATCCTCCCTCCCCAGCTCTGG + Intergenic
1136981773 16:35065918-35065940 CCATCCTCCCTCCCCAGCTCTGG - Intergenic
1137397900 16:48129565-48129587 CCCTCCAGGCTCTCCAGCTGTGG - Intronic
1137785627 16:51135036-51135058 CCCTGCTCGGCCTCCGGGTCCGG - Intergenic
1138551640 16:57751923-57751945 CCCTGCCCTGCCTCCAGCTCTGG + Exonic
1138714493 16:59005510-59005532 CCGTCATGGCACTCCAGCTCTGG + Intergenic
1139431320 16:66912425-66912447 CCCTCCTCCTCCTCCAGATTGGG - Exonic
1139469814 16:67172101-67172123 CCCTCCTCTGCCTCCTTCTCTGG - Intronic
1139601959 16:67992682-67992704 GCCTCTTAGCCCTCCAGTTCAGG + Intronic
1139785046 16:69385865-69385887 CCCTCCCCGCCCTCCCGGCCGGG + Exonic
1141557257 16:84844437-84844459 CCATCCCCGCCATCCATCTCTGG + Intronic
1141673068 16:85502970-85502992 CCCTCATCGCCCTCCAGCCCTGG - Intergenic
1141699985 16:85637948-85637970 GCCACCTCCCCCTGCAGCTCTGG - Intronic
1142119075 16:88377069-88377091 CCCATCTCTGCCTCCAGCTCTGG - Intergenic
1142256308 16:89015377-89015399 CCCTCCTCGTCCTCCTGCCGAGG - Intergenic
1142752708 17:1998237-1998259 CCGCCCTCGCCCTGCAGCTCCGG - Intronic
1142994712 17:3753781-3753803 ACCTGCTCTCCCTCCAGCACTGG + Exonic
1143114810 17:4576464-4576486 CCCTGCTCATCCTCCAGATCGGG - Intergenic
1143562696 17:7705111-7705133 TCCGCCTCGAGCTCCAGCTCCGG + Intergenic
1143866289 17:9926241-9926263 CCCTGCTCTCCTTCCTGCTCAGG - Intronic
1144781218 17:17809594-17809616 CCCCCGCCGCCGTCCAGCTCAGG + Intronic
1145757688 17:27404675-27404697 CCCTCCTCCCTCTCCAGACCAGG + Intergenic
1146355145 17:32127352-32127374 CCCTGCTGGTCCCCCAGCTCAGG - Intergenic
1147200793 17:38799803-38799825 CCCTCCTCCCCTTCCGGCTCCGG - Exonic
1147425590 17:40344556-40344578 TCCTCCTCCCTCTCCAGTTCTGG - Intronic
1147430320 17:40366865-40366887 CCCACCACTCCCTCCAGCTCAGG + Intergenic
1147466079 17:40612056-40612078 GCCTCCTTCCCCTCCAGCTGGGG - Intergenic
1147702602 17:42405303-42405325 AGCTCCTCGCCCTCCTTCTCTGG + Exonic
1148490982 17:48023938-48023960 CCCTCCGCGCCCGCCGGCTCCGG + Intergenic
1150590639 17:66559175-66559197 CCCTCCAAGCCCTCCAGGCCGGG + Intronic
1151450740 17:74196879-74196901 CCCTCCTCTCCCTCCTGCAGGGG + Intergenic
1151531295 17:74706819-74706841 CCCTCCTTCCACTCCAGCCCGGG + Intronic
1151542142 17:74770038-74770060 CCTTCCTGGACCTCCAGATCAGG - Intergenic
1151801624 17:76382883-76382905 CCCTCCTCTTCCTCCAGCGAGGG - Intronic
1152241480 17:79163556-79163578 CCCATCCTGCCCTCCAGCTCTGG - Intronic
1152420699 17:80191491-80191513 CCCTGCCTGGCCTCCAGCTCGGG - Intronic
1152557753 17:81062925-81062947 CCCGCCGCCCCCACCAGCTCTGG + Intronic
1152602000 17:81267974-81267996 TCCTTCTCTCCCTCGAGCTCTGG - Intronic
1153975893 18:10268243-10268265 CCCTCCTCTCACTCCATCTTTGG + Intergenic
1154383901 18:13876228-13876250 CCCTCATTGCCCAACAGCTCAGG - Intergenic
1158099855 18:53818947-53818969 CCTTCCTCCTCCTCCAGCCCAGG - Intergenic
1158119301 18:54030572-54030594 CCCTCCTTCCCCTCTAACTCTGG - Intergenic
1158590431 18:58774429-58774451 CCCTCCTCGCCCCCAAGGTGGGG + Intergenic
1159100108 18:63949231-63949253 CCCGCCCCGCCCTCCTGCCCAGG + Intergenic
1160419599 18:78735088-78735110 CCCTCCAAGCCCTCCTGCTCTGG + Intergenic
1160432285 18:78819923-78819945 CCCTCCTCCCCCTCCTGCAGAGG - Intergenic
1160726678 19:620709-620731 CCCTCCTCCCCCGGCAGCTCCGG - Intronic
1160983419 19:1827008-1827030 TCCTCCTCCACCTCCAGCGCGGG - Exonic
1161006831 19:1941305-1941327 GCCCCCTCGCGCTCCGGCTCCGG - Exonic
1161046837 19:2139602-2139624 CCCTCCTCTCCTTCCAGGTGGGG - Intronic
1161392376 19:4028238-4028260 CCCTCCCCGCCCCCCAGTCCTGG + Intronic
1162315506 19:9936181-9936203 CCCTCGCCGCCCTGCAGCTGGGG + Intronic
1162380312 19:10328024-10328046 CCAGCCCCGCCCTCGAGCTCGGG - Intronic
1162583595 19:11545606-11545628 CCCTCATCTCCCTGCAGCTTGGG - Intronic
1162895577 19:13763145-13763167 CCCGGCTCGCCCACCAGCCCTGG + Exonic
1163463853 19:17455131-17455153 CCCTCCCAGCTCTCCACCTCCGG + Intronic
1163663263 19:18590881-18590903 TCCTCCTGCCCCGCCAGCTCTGG - Exonic
1163740717 19:19010107-19010129 CTCTCCTCGCCTTCCAGCCCCGG + Exonic
1163770726 19:19189527-19189549 CCTTCCTTGCCCTCCACCCCTGG + Intronic
1164723025 19:30445711-30445733 CCCTCCTCGCCATCCTCCTCAGG + Exonic
1164925203 19:32124798-32124820 CCCTCCTCCCCCTCCCACACTGG + Intergenic
1165227611 19:34365656-34365678 TCCTCCTCCCCGTGCAGCTCTGG + Intronic
1165331407 19:35142846-35142868 CCCTCGCCGCCCTTCAACTCTGG - Intronic
1165726204 19:38114814-38114836 TCCCCCTCGCTCTCCATCTCTGG - Intronic
1165738636 19:38192982-38193004 CCAACCCCACCCTCCAGCTCCGG - Intronic
1165860673 19:38907585-38907607 TCGTCCTCGCCCTCGGGCTCAGG - Exonic
1165879263 19:39031456-39031478 CCTTCCCCTCCCACCAGCTCAGG + Intronic
1166089206 19:40497427-40497449 CCCTGCTTGCCCGCCGGCTCTGG + Intronic
1166621426 19:44304848-44304870 CCAACCCCGCCCTCCAGCGCTGG + Intronic
1166743575 19:45129253-45129275 CCCTGCTCGCACTACAGCCCTGG + Intronic
1166816673 19:45550512-45550534 CCCTCCTCACTCTGCAGCTGGGG + Intronic
1166854739 19:45777910-45777932 CCCTCTGGGCCCACCAGCTCTGG + Intronic
1166873581 19:45884600-45884622 GCCGCCTCGCCCTCCGGCTCGGG + Exonic
1166990949 19:46692467-46692489 CCCTGCTCGCCCCCCAACTCTGG + Intronic
1167349008 19:48963467-48963489 CCCTCCTCTCCCTCCACCTATGG + Intergenic
1168019374 19:53597677-53597699 CCCGCCTCGGCCTCCAGGGCTGG + Intergenic
925359255 2:3266227-3266249 ACCTCCTCCTCCTCCAGCTGGGG - Intronic
925610387 2:5696816-5696838 CCCTCCCCGCGCGCCGGCTCAGG + Exonic
925987853 2:9230639-9230661 TCCTCCTCGCCAAGCAGCTCAGG - Intronic
927086850 2:19680437-19680459 TCCTCTTCCCCATCCAGCTCAGG + Intergenic
927277217 2:21272339-21272361 CCCACCTGGCCCTACAGCACTGG - Intergenic
928115439 2:28542624-28542646 CGCTCCTCTCCATCCATCTCTGG + Intronic
929187638 2:39111974-39111996 CCCTCCTTGGCCTCTATCTCTGG + Intronic
929960222 2:46490655-46490677 CCCTGCATGCCTTCCAGCTCTGG + Intergenic
930996045 2:57719712-57719734 TTCTCCTCTCCCTCCAGCCCTGG - Intergenic
931429387 2:62196671-62196693 CCCACCTCGCCCTGGAGCCCGGG + Intronic
931627454 2:64269832-64269854 CCCTCCTCTTCCTCCTCCTCAGG + Intergenic
931942975 2:67273304-67273326 CCCTCCTGGCACTCCAGACCTGG + Intergenic
932575027 2:72958099-72958121 CCCACCCAGGCCTCCAGCTCTGG - Intronic
934653190 2:96104031-96104053 TCCTCTTCCCCCTCCATCTCTGG + Intergenic
935971518 2:108534440-108534462 CCTTCCTCCCCTTCCTGCTCCGG + Intronic
936232114 2:110712168-110712190 CCCTCCTCACCCTGCTGGTCTGG + Intergenic
937335672 2:121060851-121060873 CCCTCCTGGCGCTTCAGTTCTGG + Intergenic
937725902 2:125166226-125166248 TCCTCCTGGCCCCTCAGCTCTGG - Intergenic
937905346 2:127050264-127050286 TCCTCCCCGCCCTCCACGTCGGG - Intronic
938128286 2:128690234-128690256 CCCTCTCTGCCCCCCAGCTCCGG - Intergenic
938780179 2:134577571-134577593 CTCTCCTGGCCCTGCACCTCTGG - Intronic
940811210 2:158244790-158244812 CCCTACTCACCCTCCAGCCGTGG - Intronic
942146686 2:173034211-173034233 GCGTCCTCTCCATCCAGCTCAGG + Intronic
945780550 2:214166405-214166427 CCCTCCACGCCCCCGGGCTCGGG + Intronic
947119453 2:226799946-226799968 CCCTGCGCGGCCGCCAGCTCCGG + Intergenic
947822167 2:233079669-233079691 CCCTCCTTTCCCTTCATCTCTGG - Intronic
948283355 2:236765699-236765721 CCCACCCTGCCCCCCAGCTCTGG + Intergenic
948502772 2:238407106-238407128 CCCTCCTCCTCCTCCTCCTCGGG - Intergenic
948547031 2:238740048-238740070 CCCTCCTCCACCTCCTGCCCTGG - Intergenic
948565449 2:238883510-238883532 TCCGCCTCGCTCTGCAGCTCTGG - Intronic
948605870 2:239134387-239134409 CCCTTCCCGCCCTCCAGCAGAGG - Exonic
948661394 2:239508804-239508826 CCCTCCTCACGCTCCAGCCTGGG + Intergenic
948691830 2:239711129-239711151 CCCACCTGGACCTCCAGCTCAGG + Intergenic
948795988 2:240402311-240402333 CCTTCCTCTGCCCCCAGCTCAGG + Intergenic
948805501 2:240452144-240452166 CCCTCCCCTCCCTGCAGCCCAGG - Intronic
948887682 2:240892282-240892304 CGCTCCACCCTCTCCAGCTCTGG - Intronic
948947209 2:241226875-241226897 CCCTCCTCCTCCTCCAGCCGAGG + Intergenic
1169064719 20:2688471-2688493 CCCTCCTCACCTTCAGGCTCAGG + Intergenic
1169077759 20:2771944-2771966 GCCTCTTCGCCCTCCAGCGGTGG + Intergenic
1169208316 20:3752276-3752298 CTTTCCACGCCCTCCAGCCCCGG + Exonic
1169216047 20:3795545-3795567 CCCTCCTCGACCCCCAGCCGCGG + Intronic
1169268276 20:4180877-4180899 CCCTCCCCTCACTCCAGCTGGGG - Intronic
1169859379 20:10135364-10135386 CCCTTCTCGCCATCCTGCTCAGG - Intergenic
1171174870 20:23044060-23044082 CCCTCCTTCCCCTTCAGGTCTGG + Intergenic
1171381003 20:24734219-24734241 CCCACCTCCCCTTCCAGGTCTGG + Intergenic
1172020064 20:31907926-31907948 TCCTCCCCGCACCCCAGCTCTGG + Intronic
1172149382 20:32779694-32779716 CCCTCCTCCCTCACCAGCTGGGG - Intronic
1172474366 20:35226436-35226458 GCCTCTTCCCCCTCCTGCTCAGG + Intergenic
1172581330 20:36050881-36050903 CCCTCCAGGCCCTCCGGCCCCGG - Intergenic
1172847502 20:37938597-37938619 CCCTGCTTGCCCCACAGCTCAGG - Intronic
1173727618 20:45308331-45308353 CCCTCCCCACCCGCCAGCCCTGG - Intronic
1174173736 20:48632373-48632395 CCCTCCACGTTCTCCAGCACTGG + Exonic
1175296808 20:57914125-57914147 CCCTCATGGCCCTCCAGGTAGGG + Intergenic
1175479390 20:59300710-59300732 CTGGCCTCGCCCTCCAGCTGTGG - Exonic
1175823694 20:61925131-61925153 CCATCCTCGCCCTCCCGTCCAGG - Intronic
1175900406 20:62357788-62357810 CCATCCTCTCCCTCCAGCTGGGG - Intronic
1175945513 20:62556725-62556747 ACCCCCTCGCCTGCCAGCTCGGG + Intronic
1175999767 20:62826592-62826614 CCCTGCTTCCCCTCCTGCTCTGG - Intronic
1176072505 20:63234515-63234537 CCCTCTGCGCCCTGCAGCCCTGG + Intergenic
1176261700 20:64185306-64185328 CCCTCCTCCGTCTCCAGCACAGG - Intronic
1176285317 21:5016245-5016267 CCCTCCTCCTCCTCCTCCTCAGG - Intergenic
1178881554 21:36454098-36454120 GCCTCCAAGGCCTCCAGCTCTGG - Intergenic
1179491086 21:41741992-41742014 CTCTCCTCTCCCTGCAGATCTGG - Exonic
1179641189 21:42748028-42748050 CCCTCCTCTGCTCCCAGCTCTGG + Intronic
1179871864 21:44247230-44247252 CCCTCCTCCTCCTCCTCCTCAGG + Intronic
1179984763 21:44914136-44914158 CCCTCCTCATCCTCCAGCTCTGG + Intronic
1180052032 21:45335704-45335726 CCCTCCTCGCCCTCCAGGGACGG - Intergenic
1180210993 21:46295497-46295519 TCCTCCTCTTCCCCCAGCTCTGG + Intronic
1180244569 21:46538466-46538488 CCATCCTCTCTCTGCAGCTCGGG + Exonic
1181127666 22:20711298-20711320 CCCTCCTCTCCCTTCACCCCTGG - Intronic
1181312043 22:21950151-21950173 CCCTCATTGGCCACCAGCTCTGG + Intronic
1181998694 22:26903135-26903157 CCCTCCCCGACCTCAAGGTCAGG - Intergenic
1182217896 22:28734549-28734571 CAGTCCTCTCACTCCAGCTCTGG - Exonic
1183151790 22:36043410-36043432 CCCTTCTCCCCGACCAGCTCTGG - Intergenic
1183227963 22:36563324-36563346 CCCTCCTCACCCCTCACCTCAGG - Intergenic
1183230470 22:36578832-36578854 CCATCCACCCCCTCCAGCACAGG - Intronic
1183314348 22:37128805-37128827 CCCTCATCGTCCTTCAGCCCTGG - Exonic
1183617342 22:38953759-38953781 ACCTCCTCCCACTCCAGCCCTGG - Intronic
1183663274 22:39233823-39233845 CCCTCCTCGGCCTCCAGGGCGGG + Intronic
1183710200 22:39498841-39498863 CCCTGCTCCCCCTGCAGCTAAGG + Intergenic
1183976788 22:41516974-41516996 CCCACCTCGGCCTCCATCACTGG + Intronic
1184220227 22:43095147-43095169 CCCTCGTCTCCCACCAGCTCTGG - Intergenic
1184415331 22:44348859-44348881 CCTTCCTCCCACTCCAGGTCTGG - Intergenic
1184471729 22:44699796-44699818 ACCTGCTTGCCCTCCAGCTGCGG - Intronic
1184580431 22:45413244-45413266 CGGTCCTCGCCGTCCACCTCAGG - Intronic
1184770618 22:46594679-46594701 CCCTCCTAGCCCCCCAGGGCAGG - Intronic
1184799213 22:46749965-46749987 GCCTCCTCTCCCTTCATCTCTGG - Intergenic
1185028793 22:48430871-48430893 CCCTCCTCCCTCTCTTGCTCAGG + Intergenic
1185032172 22:48449875-48449897 ACATCCTGGCCCTCCAGCCCTGG + Intergenic
1185072905 22:48667037-48667059 CCCTCCTCCCCCTCAATCCCAGG - Intronic
1185326355 22:50227678-50227700 CCATCCAGGCCCTCCAGGTCCGG - Intronic
1185333166 22:50260685-50260707 CCCTCCTCCCCCTCCACCACCGG + Intronic
950194304 3:10998437-10998459 CCTTCCTCTCCCTCCAGGCCTGG - Intronic
950463851 3:13141697-13141719 CCCTCCTCGACCTACATATCAGG + Intergenic
950503778 3:13380700-13380722 CCCTCCTCTCAGGCCAGCTCAGG + Intronic
950571788 3:13804915-13804937 CCCTCCTCTTCCTCCTCCTCAGG + Intergenic
950719982 3:14875772-14875794 CCCTCCACTCCCTCCAGCCTGGG - Intronic
951620970 3:24602166-24602188 CCCTTCTCTCTCTCCTGCTCTGG + Intergenic
954224038 3:49171518-49171540 CCCCCCTCCCCCTCCGACTCAGG - Intergenic
954303060 3:49711350-49711372 CCTTCATCTCCCTCCAGCACAGG + Intronic
954364218 3:50137781-50137803 CCCTCCTGCTCCTCCAGCCCTGG + Intergenic
954637542 3:52079397-52079419 TCCTCCTCACCCTCCAGGGCAGG - Intronic
954664807 3:52246057-52246079 CCCTCCCCGACCCCCAGCTCAGG + Intronic
954707221 3:52487470-52487492 CCCTCCTCCTCCTCCACGTCTGG - Exonic
954717440 3:52533640-52533662 TCGTCCTCGCCCTCCTGCCCTGG - Exonic
954759245 3:52862007-52862029 CCAGCCTCTCCCTCCAGCCCTGG + Intronic
956378908 3:68645125-68645147 CCTTACTCCCCCTGCAGCTCAGG + Intergenic
957007134 3:74962827-74962849 CCCTCCTTATCCTCCTGCTCCGG + Intergenic
958046364 3:88288655-88288677 CCCTCCTCCCCACCCAGTTCAGG - Intergenic
958197153 3:90255911-90255933 GCAGCCCCGCCCTCCAGCTCAGG - Intergenic
959648162 3:108725971-108725993 CTCCCCTCTCCCTCCAGCTCAGG - Intergenic
961239447 3:125397658-125397680 CCCTCCTGTCCCTGCAGCACTGG - Intergenic
961312435 3:126012061-126012083 CCCTCCTGTCCATTCAGCTCAGG + Intronic
961459733 3:127042754-127042776 CCCTCCTCCCCCTGCCCCTCTGG + Intergenic
961681693 3:128604008-128604030 CCCCCCTCGCCCACGGGCTCCGG + Intergenic
963045752 3:141101423-141101445 ACCTCCTCGCTCTGCAGCTGGGG + Intronic
964129642 3:153272565-153272587 CCCTCCGCCCCCTCCTGCTCTGG + Intergenic
966235895 3:177701105-177701127 CCCACCTAGCCCTCCAGCCTCGG + Intergenic
966932685 3:184686021-184686043 CCCTCCCCACCTTCCAGCCCCGG + Intergenic
967946037 3:194804989-194805011 GGCTCCTGGACCTCCAGCTCAGG - Intergenic
967986732 3:195100749-195100771 CCCTCCTCGCCCCCAAGCCTTGG + Intronic
968064901 3:195753225-195753247 CCCTACTCACTCTGCAGCTCTGG - Exonic
968293293 3:197555247-197555269 CCCTCCTCCTCCTCCTCCTCCGG - Intronic
968494989 4:910489-910511 CCTTGCTCGCCCTCCATTTCTGG + Intronic
969326738 4:6448573-6448595 CCCTTCTCTCCCTCCGTCTCAGG + Intronic
970899946 4:21147126-21147148 ACCTCACCTCCCTCCAGCTCAGG - Intronic
972775801 4:42239399-42239421 CCCTCCCCTCTCTCCAGCACAGG + Intergenic
972780479 4:42282895-42282917 CCTTCCTCCCCTTCCAGCCCAGG + Intergenic
974855310 4:67453833-67453855 CCCTTCTCTTCCTCCTGCTCTGG + Intergenic
982068544 4:151675199-151675221 CCCGCCTGGCCCTCCTTCTCGGG - Intronic
983010176 4:162537335-162537357 CCCTCCTCCTACTCCATCTCTGG - Intergenic
984324399 4:178233681-178233703 CCCTCCCCTCCCTCCACCACAGG + Intergenic
986125989 5:4882726-4882748 CCAGCCTGGCCCTCCAGCCCTGG - Intergenic
987234311 5:15927985-15928007 ACCTCCTCGTCCTCCATCACCGG + Exonic
987313359 5:16701408-16701430 CCCTCATCGACCTCCTCCTCTGG + Exonic
992093401 5:73339165-73339187 CCCCTCCTGCCCTCCAGCTCTGG - Intergenic
997470200 5:134113301-134113323 CCCCCCTCCCCCGCCACCTCCGG - Intergenic
998374297 5:141681089-141681111 CCTTCCTGTCCCTCCAGCCCTGG + Intronic
999132895 5:149298135-149298157 ACCTCCAGGCCCTGCAGCTCCGG + Intronic
999361891 5:150992540-150992562 CCCTCCTCCTCCTTCAGCTCCGG - Intergenic
1000319006 5:160119108-160119130 TTCTCCTCAGCCTCCAGCTCCGG + Exonic
1002140503 5:177134483-177134505 GCCTCTTCGCCCTGCAGCTGCGG + Intronic
1002322299 5:178383142-178383164 CCCTCCCCCTCCTCCAGCTCTGG + Intronic
1002347966 5:178561206-178561228 CCCTCCTAGCCCACCAGCCTGGG + Intronic
1002532796 5:179858690-179858712 CCCTCCTCCTCCTCCGGCGCGGG - Intronic
1003092308 6:3114536-3114558 CCCTTCTCGCCCTCCCTCTGGGG - Exonic
1003775166 6:9352280-9352302 CCCTCCTCTTTCTCCTGCTCTGG + Intergenic
1004512992 6:16297661-16297683 TCCTCCTCCTCCCCCAGCTCTGG - Intergenic
1004952373 6:20688122-20688144 CCCCCCTCACCCCCCACCTCTGG + Intronic
1005046856 6:21651510-21651532 CCCCCGTCTCCCTCCTGCTCTGG - Intergenic
1007264373 6:40586055-40586077 CTCTCTTCTCCCTCCTGCTCTGG + Intronic
1007763943 6:44150207-44150229 TGCTCCCCTCCCTCCAGCTCTGG + Exonic
1007839586 6:44704766-44704788 GCCTCCTTGCTCTCCAGCTTGGG - Intergenic
1008011946 6:46477171-46477193 CCCTTCTCTCTCTCCAACTCTGG + Intronic
1011419426 6:87155791-87155813 CCCTCTTCCCCCTCTAGCTGGGG - Intronic
1012992311 6:105938563-105938585 CCCTCCCTTCCCTACAGCTCTGG - Intergenic
1014340338 6:120197654-120197676 CCCTCCTCCTCCTCAAGCTCTGG + Intergenic
1014493057 6:122086522-122086544 CCCACCTCTTCCTCCTGCTCTGG - Intergenic
1015438096 6:133213718-133213740 CCATCCTCACCATCCATCTCTGG - Intergenic
1018186026 6:161265685-161265707 CCCTCCCCACCCACCAGCTAAGG - Intronic
1018705482 6:166460820-166460842 CCCTCATGGCCGTGCAGCTCTGG + Intronic
1018862308 6:167720057-167720079 CCCTCCTCTCCCTGCGCCTCTGG - Intergenic
1019531082 7:1503872-1503894 CCCTCCTCGCTCTGCAGCCCGGG - Intronic
1019606166 7:1911304-1911326 CCCTCCTCTCCCTCCTCCTCAGG + Intronic
1020359886 7:7316443-7316465 CCCCCATCCCCCTCCAGCACAGG - Intergenic
1020748650 7:12111707-12111729 CCCTGCGCGCACTCCATCTCAGG - Intergenic
1021037070 7:15812668-15812690 CCTTCCTCGCTCCCCTGCTCTGG + Intergenic
1021311877 7:19106846-19106868 CTTTCCCCGCCTTCCAGCTCAGG - Intronic
1021604101 7:22393349-22393371 CCTTCCTCGCCCTCCCATTCTGG + Intergenic
1022732356 7:33041302-33041324 CCATCCTCCTCCTCCAGCCCTGG - Intronic
1024615675 7:51109509-51109531 CCCTCCTTGCCCCCCACCCCTGG + Intronic
1024963736 7:55004283-55004305 CCTTCCCGGCCCTGCAGCTCAGG + Intergenic
1025259913 7:57412097-57412119 TCCTCCTCCCCCTGCAGCTCTGG + Intergenic
1026048045 7:66921467-66921489 CCCAGCCCGCCCTCCAGCCCCGG - Intronic
1028373436 7:90119637-90119659 ACCTCCTCTACCTCCGGCTCCGG - Intergenic
1028567171 7:92246100-92246122 CCCTCCCCCGCCTCCGGCTCCGG - Exonic
1028899146 7:96076217-96076239 CCCTCCCAGCCCTCCGGCCCGGG - Intronic
1029217618 7:98962633-98962655 CCCTCCTCAGCTTCCAGCACAGG + Intronic
1029392948 7:100287694-100287716 CCCCCCCTTCCCTCCAGCTCTGG + Intergenic
1029474251 7:100773606-100773628 TCCTCCTCGCCCCCCAGCCTTGG - Intronic
1029587874 7:101486968-101486990 CCTTCCTCCCCCTCCAGCCCTGG - Intronic
1030075716 7:105734563-105734585 CCCTCCTTGCCCTCCAGCTGAGG + Intronic
1031960739 7:127987392-127987414 CCCTCCTCTCCCAAGAGCTCAGG - Intronic
1032021572 7:128409701-128409723 CCCTCCTCGGCCGCCCGCCCCGG + Intronic
1032075997 7:128836476-128836498 CCGTCCCCCTCCTCCAGCTCTGG + Intronic
1032345174 7:131110069-131110091 CCCTCCTCCCCCTCCAGCTCCGG - Intergenic
1033273121 7:139950680-139950702 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273130 7:139950704-139950726 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273139 7:139950728-139950750 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273148 7:139950752-139950774 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273157 7:139950776-139950798 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273174 7:139950824-139950846 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033273183 7:139950848-139950870 ACCCCCTCGCCCTCCATCTACGG + Intronic
1033860203 7:145615279-145615301 CCTTCCTCCCCATCCAGCACAGG + Intergenic
1034801444 7:154058602-154058624 CCCTCTTCCCCCCCCAGCTTAGG + Intronic
1034984062 7:155496704-155496726 CCCTGCTCTCCCCGCAGCTCAGG + Intronic
1035245480 7:157559957-157559979 CCCTCCCCTCCCTCCAACACAGG - Intronic
1035751687 8:2001379-2001401 ACCTCCCCGCCCTCCAGCGGTGG + Exonic
1036656389 8:10679915-10679937 CCTTCCTCACTCTCCAGCTGAGG - Intronic
1036926888 8:12915837-12915859 CCATCCAACCCCTCCAGCTCAGG + Intergenic
1037682366 8:21108195-21108217 GCCTCCTCCCTCCCCAGCTCTGG + Intergenic
1037988054 8:23301982-23302004 CCCTCCTCCCCCTGCAGGGCTGG + Intronic
1038058639 8:23886948-23886970 CCTTCCTCCCCCTGTAGCTCTGG - Intergenic
1039893462 8:41699705-41699727 CAGTCCTGGTCCTCCAGCTCTGG + Intronic
1039983729 8:42430036-42430058 CCCTGCTCGTCCACCAGCCCAGG + Intronic
1041670354 8:60485478-60485500 CCCTCCTTGCCCTGCTGCCCTGG - Intergenic
1045305273 8:100952206-100952228 CTCCGCTCGCCCTCCAGCGCGGG - Intronic
1046454596 8:114441188-114441210 CCCTGCTCTCGCTCCAGCCCAGG - Intergenic
1047731896 8:127735294-127735316 CCCTCCTGCCCCGCCTGCTCAGG - Intergenic
1048301439 8:133254176-133254198 TCCTCCTCTCCCTCCTCCTCAGG - Intronic
1049252514 8:141596852-141596874 CCCTGCTCTCCCTCCAGCTTGGG + Intergenic
1049339796 8:142105970-142105992 CCCCCCACTCCCTCCAGGTCAGG + Intergenic
1049406511 8:142453954-142453976 CCCACCTTCCTCTCCAGCTCTGG - Intronic
1049580181 8:143407520-143407542 CCCGCCCCACCCTCCAGGTCGGG + Intergenic
1049936552 9:505330-505352 GCCTCCCCGCCCTCCAGCCCCGG - Intronic
1050959257 9:11706368-11706390 CCCTCCTCGGCCTCCAAAGCTGG - Intergenic
1052978429 9:34429407-34429429 CCCTCCTCACTCACCAGCTCAGG + Intronic
1054430646 9:65156982-65157004 TCCTCCTCCCCGTCCAGCTTGGG + Intergenic
1054764960 9:69035742-69035764 CCCGCTCCGCCCTCCAGCGCTGG - Exonic
1055961250 9:81822329-81822351 CCCTTCTCCCCCTCCACCTTTGG + Intergenic
1056796810 9:89664182-89664204 CCCACCTGGACCGCCAGCTCTGG - Intergenic
1057869403 9:98707472-98707494 CGCTCCGCGCGCTCCAGCCCCGG + Intronic
1060051214 9:120379774-120379796 CCCAGCTCTGCCTCCAGCTCGGG + Intergenic
1061160724 9:128892473-128892495 CTCCCCTCCCCCTCCAGCCCTGG + Intronic
1061232146 9:129321265-129321287 CCCTCCTCCCCGCCCAGCTGAGG + Intergenic
1061248809 9:129414767-129414789 CCCGCCTCGCCCGGCAGCCCAGG - Intergenic
1061387930 9:130301432-130301454 CCTTCCCCGCCCTCCAGGTCTGG + Intronic
1061748557 9:132757907-132757929 CCCTCCTCGTGCTCAAGCTGTGG - Intronic
1061952523 9:133944304-133944326 CCTGCCTCGCCCTCCAGAGCTGG + Intronic
1061954806 9:133955861-133955883 CCCTCTAAACCCTCCAGCTCAGG + Intronic
1062202271 9:135309841-135309863 CCCTCCCTGCCCTCCAGTTCTGG - Intergenic
1062285388 9:135770502-135770524 CCCTCCCCACCCTCCCGGTCAGG + Intronic
1062308624 9:135923620-135923642 CCCTCCTCTCCCTCCAGTCCTGG + Intergenic
1062421288 9:136483824-136483846 CCCTCCGCGTCCCGCAGCTCCGG - Exonic
1062568492 9:137173727-137173749 CCCTCCCACCTCTCCAGCTCTGG - Intergenic
1062568512 9:137173810-137173832 CCCTCCCACCTCTCCAGCTCTGG - Intergenic
1062670458 9:137705879-137705901 CCCTCCTCTCCCCACAGCTCTGG + Intronic
1185480071 X:439265-439287 CCCTCCTCCAACACCAGCTCTGG - Intergenic
1186861321 X:13675158-13675180 CCCACCTCGGCCTCCAGTGCTGG - Intronic
1186979120 X:14939939-14939961 CCCTCCTCCCCCTCCCACTGTGG + Intergenic
1187038028 X:15563294-15563316 CCTGCCTCGCCCTCCAGTGCTGG - Intronic
1187619616 X:21036800-21036822 CCCTCCTCTTGCTCCTGCTCTGG - Intergenic
1187665962 X:21609545-21609567 TCCTCCTCTTCCTCCACCTCTGG - Exonic
1188721604 X:33529140-33529162 CCCTCCTAGTCCTCTGGCTCTGG + Intergenic
1189414938 X:40805072-40805094 CCCCCCTCCCCTCCCAGCTCGGG - Intergenic
1194072957 X:89350491-89350513 CCCTGCTCCCACTCCAGGTCAGG + Intergenic
1194192677 X:90857177-90857199 CCCTTCTCTTCCTCCTGCTCTGG + Intergenic
1197760419 X:130024216-130024238 CCCTCCTCCCCCACCACCCCAGG - Intronic
1200259106 X:154602511-154602533 CACTCCTCGCCTTAGAGCTCTGG - Intergenic
1200292198 X:154885251-154885273 GCCTCGTTGCCCGCCAGCTCCGG - Exonic
1200320178 X:155180238-155180260 CCCTCCCCACCCTTCATCTCTGG + Intergenic
1200539305 Y:4439626-4439648 CCCTTCTCTTCCTCCTGCTCTGG + Intergenic
1200727196 Y:6686231-6686253 CCCTGCTCCCACTCCAGGTCAGG + Intergenic
1200728348 Y:6702006-6702028 CCCTGCTCCCACTCCAGGTCAGG + Intergenic