ID: 1066220849

View in Genome Browser
Species Human (GRCh38)
Location 10:33335466-33335488
Sequence GGGAGCCGCACCGCGAAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066220839_1066220849 17 Left 1066220839 10:33335426-33335448 CCAGAGCTGGAGGGCGAGGAGGG 0: 1
1: 1
2: 3
3: 60
4: 435
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220835_1066220849 22 Left 1066220835 10:33335421-33335443 CCTGCCCAGAGCTGGAGGGCGAG 0: 1
1: 0
2: 10
3: 30
4: 313
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220834_1066220849 23 Left 1066220834 10:33335420-33335442 CCCTGCCCAGAGCTGGAGGGCGA 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220837_1066220849 18 Left 1066220837 10:33335425-33335447 CCCAGAGCTGGAGGGCGAGGAGG 0: 1
1: 0
2: 3
3: 59
4: 486
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data
1066220833_1066220849 24 Left 1066220833 10:33335419-33335441 CCCCTGCCCAGAGCTGGAGGGCG 0: 1
1: 0
2: 7
3: 43
4: 278
Right 1066220849 10:33335466-33335488 GGGAGCCGCACCGCGAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066220849 Original CRISPR GGGAGCCGCACCGCGAAGCC GGG Intronic
No off target data available for this crispr